Fosmid29B7 40351 bp


AGGTCGGGCCCCATCACCACGGAGACGTGGTAAAGTTTAGCAAGGACCCC
AATGGCCATAAGCAAAATGATGGCTGTGAATACTGCCATCCATTGCCGCC
CTTTCCCAGCTGACTTATTCATGGTTAATGATTTGAATGGGTGCTTTGTC
GGCCGCAATCAGGCCCAATGATTTGACTCTGCGCTTGACGGAACTTTCCG
TGCCCATGGTCATCAAGGATGAAAGCGACTCCAAGTACTCAGATTCCAAT
TCATCATAGGTGACCTTCAATTCATCGATATGCGTCACGTTGTCCTCAGC
GCGGTGGGCGCCATAGATCGCAAGCAGAGACAGCAGGACCAAGTAGCCAG
CAAAAGGCAGGTTGCGGAGTACCAGGGGATGCCCCCAGAATCCACCCCGC
AAGATCTCTTTTGCCGCTCGGCTTGATTGCTTGATTCGTTGTTTCAGCCC
CATGTTGGCTCGATTTTCTCCACCACACGAAGTTTGGCACTTCGCGCTCT
GGGGTTGATGGCGATTTCCTCTTGGCTAGCAACCAAAGGTTTCCTTGTGA
TTCGATCAAAGATTTCATAGCGCCTGCCATGGTCATCTCTGGCTGCTTCG
CCTTCCAGCACGCCTTCTTTGAAAAAGCGTTTGACGCGACGATCCTCTAG
GCTGTGGTAGGACATCACAACATAGCGTCCGCCAGTCTTGAGCAGGTTGG
CGCCATCCACTAGCAGGCTGTCAAGCACAGCCAGCTCACGGTTGACTGCA
ATGCGTATGGCTTGAAACACCTGTGCGGGGAGCTTCTTGCCTCGAGGCCC
CTTGCACATGGGCTGAAGGCATTCGTACAAGTCCTCGGTCCATGTCATCT
GGCCGGCGTCTCTGGCTTGAATGATGGCTGTTGCCACCCGCCCAGCTTGA
TGCACGTCACCAAATTCGCGAAGGGTCTGTGCCAGTTGCTCCCATGTCAC
AGTTTCTAACCACTCTCTGGCACCAGGTCCCGATTGCGGGTTCATTCGCA
TGTCAAGCTCAGCGTGCTGTCGAAAGGAGAATCCCCTGCTGCCCTCATCG
AGTTGGTGACTGCTCACCCCAAGGTCAGCAAGGATGCCATCGACAGCTGT
TACCTTGTGCAGGCGCAGTATCCGTGTGATGTGCTCAAAATTGAAAGGGA
GCAGTTGAAAACGGTCATCATTGGGTGCGTTTTTGCTGGTGTCGGGGTCT
TGATCAAAGCCAAACAATTTACCCTCAGGCCCCAGCTGATCTAGAATGGC
TCGACTGTGTCCGCCTCCGCCGAAGGTGGCGTCGACATAAATGCCATGGG
GTTGTATATGGAGGTGTTGGATGCAGGCGTCGAGCAGGACAGGGTCATGG
TAGGTCATCGTGCGCTTCCCCTTGATTGCCCATGACGTCCTCTGCCAGGG
CCGCGATGTCTATGTCATCGCGATTCAACTCTTTCTCGTAATCTGCTTCA
TTCCAGATCTCTATGCCCATCGTTGTGGCTGAAAAAACGATGCCTTCGGT
TAAGTTGGCATGTCTCAATAGGTCTTTAGGAATCAGAATTCTTCCCGCTG
CATCCATGTCAATCAGTTTCACGCCAGCGTGAAATAGACGCACAAAATCT
GCGTTTTTCTTCACAAATCGATTGAGTTCCCCCACTTGGTCAGAGACCTT
TCTCCATTCTGCCTGGCTGTGCAATTCCAAGCACTGATTGAATATGCTGC
GCTTGATGATGAAGCCACCCTCACCCAATGCAAGGAGTTGACGCTTCAAC
CCTACGGGGAGAGAAGCGCGACCCTTTGAGTCAAGTTTGCATGCGTAGAC
GCCGATGATGGAGCTCATGTTCTGGTTCTGATGAATTACTTCAAAATTAC
CGGAGTGTTCCCACATTACCCCACTTATTCCCACTTTTGTTGAAAACTTT
TGAAAAATGGGAATGAAAAACCACTCAAACCCTTTCTGTGATTGACTTGA
AGGGCTGTTGTTGACAAGGGGCTGTTCAAGACAGGCCCTAGAGGGCGTAT
CTTCGCCCCCTTAAACCTGACTACATGAGCGATTTCACCTTGCATCACGA
AGAAAAATTTGAATTCCTGCTTGAAGGTACTGGTCCCCCCATCATCTTCC
TTCATGGCTTGATGGGAAACCTGAGCAACTTTGGTGACCAGATTCAATTT
TTTGCTGATAACGGCTATGAAGTAAATATGCCAAAGCTGCCATTGTACAG
TCTGCCAATACACCAATCCACCGTCAAGCACTTGACCCTGTTTTTGAAGG
AATTTGTGGATCACCGTGGTCTGAATCAAGTGGTTTTGATTGGTAATTCT
CTTGGTGGTCATATTGCTTTGATGTACCAGGCCTTGTTCCCTAAATCTAC
CCTAGGTATAGTTCTCGCTGGCAGTTCAGGCTTGTATGAATCAGCCATGG
GTGGCTCATTCCCTAGACGAGGTGATAGGGAGTACATCGCAGAAAAGGTG
CGTGACGTTTTTGAAGTGAAGTCAGTGGCCACGGAAGAGTTGATTGATCT
GGTTTTTGAAACGGTTGGTAATCGCGTCAAAGCCTTGAAAACCTTATCTA
TTTCTAAAAGCGCCATCCGTCACAATATGACAGATGAATTGAAAAGCCTT
AAGGCAGAGGCATGCATTATTTGGGGCCGTCAGGACGCGGTCACACCACC
AGATGTGGCAAAGAAATTCCATGATTTGCTGCCAAATTCAGAGCTGCATT
GGATTGATAAATGTGGCCATGCAGCCATGATGGAACATCCTGATACGTTC
AATGACATCTTATTGACATGGCTAAACAAGCTCCACAAGCAGGACTGAAC
ATCAAGGCAAGTTTCATCAAATCCTCAGCTCGCAATGAAGAGTGTCCGGA
TTTGCATGTGCCTGAGTACGCATTCATTGGTCGATCTAATGTGGGGAAGT
CATCTTTGATTAACCGATTGGTCGGGAATAAATACCTAGCTAAAATCTCA
GGACGACCGGGCAAGACCCAGCTAATTAACCATTTCTCCATTGAGGATGG
GCAATGGGCCTTGGTGGATTTACCTGGCTATGGCTACGCGAAGGTTAGCA
AGATTCAACGAACAGAATTCAGCCGAATGATTGCCTACTACCTGCGCAAC
AGGAAAAATTTAGTCAACGTGTTTGTTTTGGTAGATGGTCGCCATGAACC
CCAGAAATTGGATTTAGCATTCGTCAAAAAATTGGGTAATTGGGGCATTC
CCTTTTCCATCGTTTTCACCAAGATGGATAAACTGTCAAATTCTGATTCT
GGTAAGAACCAAGCTTTAATGAATAGCACTTTGTTGAAGGAATGGGACAA
TTTGCCACCCATGTTTTTGACCTCAGCAGAGTCTGGCTTAGGTCGAAGTG
AACTGTTGGCTTACATCAGCAAACTCAACGGGGAGATTGGTCCTCATCTG
AAGAAAACAAGCTGAGTTTGTCGGCAAAATGAGCCGCATAATCTCTCAAG
TCTTCTGCCATCTTTTTTTCATCTGTCGATCGCTCCAGGCCATCTGCCAT
AGCTAGCAGGGTTTGGTGGTAGAACCGTTTCATGTCCTCCACCTGCATGC
CCTTGGTCCACAAGTCGATGCGTAAGGTGTCCTTTGCCTTAGCATCCCAT
ACGCTGAGCATGAAGGCATCAGCTTCGGCTTTTTCAATGCCACCATCCGG
TGCTGACCAGCTCATGGATTCGGGTACATGGTTCTCGTCAACCGTGACAT
CAAGGGTGATTTGTGATTGCTTGCTCATGGGATCAGTTTATGGCCGGTAG
GCGGATTGTTGAAGCAGTTGATTGTCATCGACGGATTGTGTGATGGCAAT
CAAGGATAGGTCGGCATGTTCACGCCAATGGGATTGCAGGATGCGCCAGC
CAAGCCACGCGCCAACGCGGCCAGGGATTTCACCATCCATGGTGCTCCCC
AGTTTGCTGAAGGGGGCAGGCTGTATCAACTTGCGTTTGAGGTCTGGAGA
GCTGCTGTAGAGCCAGCGTTCTTGCATAAAGGTGGACCAGATATCCCTTT
CATGGTTTTCAAGGAAGGCACGTTGTTCAGGGCCGACCCCTAACCACCGG
TAGGCGGCATCTTCCCCTAAAACGGCATGCAGCACCATCAGGTACCTGCC
TTCATGCAACATGGCATTGATCAGATCGGTGCCATTAGCCTGGGATGGGA
GAAAGGCAGAGGCCCATTGGGCAACAATTTGAGCCATGGCCATGTCAGGG
TGATGGCGACTTGCTAGATAGCGTTCTTCTTTGTCATACAGCGGATGCTC
TGCACCAAGGTATTGATCCCAAGGAAGGAACACCACCCCATCACCAATCA
AGATGGCATGATTTTCTGCCTGGCTGACCCAAGTGTAAACGTAAGTGGTG
CCTTTGATTGGCCCCGTCCAATGCGTCAGACGTGCAAAGGCCTCGTGCAA
GTCGGCATCCCAATCAGCCAATGCAGGCCGGGATTTGATCACGTCCTGGT
AAAGGCTTTGCACTGTTTCGCTCAGTAAATAGGGGGGGAAGTTGCTTTTC
CACTCCGCCTCAAACAACAGGGGATGATTGGGTGCCATGTGGTTCAATTG
CGCCATCATGTTGATGGAATCCAGCCCCAGTACAGAATCAGCAAAGTGCA
CGATGTGCAATTTCTCGCTGGGGAAGTCCAGATTGTCAACCTGCCAGGGT
TCTGTCTGGCAACTGCTGCTCAGCATAGCGGTCAATCCGGCAATCAGAAT
TACTTTAGATGGTGCATTCATATCAGTCCCCAAAGATATTGTCCCTATGA
CCAATCCCGACCCCATTGTAAGCCATATCACCAGTTGGCTGATCGCCTAT
GCGAGCAAGGCTGGCGCCAAGGGCTTTGTGCTAGGCGTTTCAGGTGGTGT
GGATTCTGCTTTGACCGCCCACCTTTGCGCCTTAACAGGGCTTGAATTGC
GATTGATGGAGCTGCCAATCCATCAACCCCCAAGCCATGTTCAACGCGGT
AAGGACATGATAGATGCCCTTTGCGGTAAACATGCACAGGTCACATCCCG
CTGCGTGGACTTGACAGATTTGTTTGACCAGCATTTGGAAGCATTGAATC
TGCCGTCAGGTCGATTGACACAGCTGGCCTTGATCAACACCCGGGCAAGG
CTGCGCATGACGACCCTTTATGCTGAAGCACAAGCGCATGGCTTGCTGGT
CGTTGGCACGGGAAACAAGGTGGAGGACTTTGGTATTGGCTTTTACACTA
AATACGGTGATGGTGGTGTGGATTTGAGCCCCATTGCAGACTTGACCAAG
TCAGAGGTTCAGGCATTGGCTCGATTCGTTGGTGTACCAGCAGCTATTTT
AACAGCAACTCCCTCCGATGGGCTCTGGGATGATGGCCGAAGCGATGAAA
TGCAAATCGGAGCCAGCTACCCAGAATTGGAATGGGCCATGGCACGATGT
GAAGCTATGGGATGGCAAGCTGGTCAACCTGTTGAACCATTGATGGCAGG
CGATGATCTCAGCGATAGGCAGTGCGAGGTGCTAGCTATTTACTGCCGGA
TGCATGCAGCCAATCAGCATAAAATGCAGCCAATTCCCATCTGCGTAATC
CCCAACAAATAGCAGGGTTATTTATTGGCAGGGCTCACCCACAAAGGGTT
GCCTGTACAGGCAGACGGTGAGGCGATGCCAATCACCTTACTCAAAGTTG
GTGCCATATCCCGAATGTAGGCGCGCTCATTGTGCATGGCCTGTGGGTTG
AATGCCTTGCCCATGAAAATCAATGGGACATGGCTGTCATAATGGTAACC
TGACCCATGGGTTGTGCCTGTGGGGCCATAGGCTAAATGCCCAGGCTTCA
ACGCGTAGAACACTTGACCACTTCGCTTATCTGACCCATTGCGACGAAGC
TGCGCATAGGGGTCTGGGGACAAGCGGATTTCCTCCCATGTCCATGCTTC
TGCGATGGCGGGGTGACCCAAGATGGCATTGCGAACTGCCACAGCAAGAT
TCTGTTCTCTGCTGCTGAGGTAAATCTGATCATTGGATAGGTTCAGAACC
TTGTCGTTGTCAATGCCAGCTTGATGCATCAAGACACGCAATTCAGCTTC
CAAATCTGCCGGTGCCCACAACTCAGCAGGAAAGCCATCAGCCTTTGCTT
GCATTGGGTTGTCAGAAGCACCGTGGTCTGCAGTGAAGGTGACCAGGTAG
TTGCCCTTGCCAACCAGCAAGTCCAATGATTCAAACAAATGCTTCAAATC
AAGATCCAACCGCAAGTACATGTCCATCACCTCTTGTGAGCGTGGCCCCA
TGGCATGCCCCAGGTAATCGGTGGCTGAAAAACTGATGGCCAGCACATCG
GTGATGTCATCTTGTCCTAAGCCCTCGGCTTTAACAGCTACCAGGGCTGC
ATCAACAAGCAGGGTGTTCCCGGCAGGCGTGGATTTGAATGCCCCGTTGT
AGGCGCTTTGCATGGCCTTCAGGTCATACGGGAAAGCGGCAGATTTTGCA
CCTTTTGGGACACGTTCAAAGTCACTCTGATCCGGTCCAGCTAAGGCATC
GTAATGTGAAACATCAAGCAGGCGATCCCAACTGCCCGTCATGTAGGATG
AGGGGGCATTGCTTCGATTGAAGCGCATCATCCATTTGGGTAGGTCATCC
ATGTAATGGCTGCTGGTGACAAAACCAGCATCGCTGTCAATCCAGTAGGC
AGCATCACCGTAATGCCCGGCAGCACAGATGGCGCCACGGTCTTTGATAG
AAAAAGCAATGACCTTGGCCTTGCCTTGGGTGGCCCATTCCAACTCATCG
GTCCAGGTGGTTGACCGGATGTTCTTGGGGCTTCGACGGTGTGCATCGCT
TGAGGAACCAACAGGGGTCACTTGATCATCTTCCACACAGTAAACGCTTC
GCTTCAGGCTGGCATCGTACCAGTCGTTAGCGATGATGCCATGAAAGCGT
GGGTCAGTTCCCGTATAAATCGTCGCATGCCCTGGTCCAGTATAGGTCGG
AGCATGGCTGTAGTGGGCGTTGATGAAGGACTCACCTTCTGACATCAAGG
TCTGAATGCCGCCGGTGTAGAGGTCTTCAAAGCGTGTCAGGTAGTCGGCG
CGCATTTGATCCACAACGATGGAAACCACCAACTTGGGTGCTTGTGTTGA
CGCTTCTTGTGTTTGCGCTTGTAGAGATTGAATGGGCCAAGCAGTTGCTA
GGGCAAGGGGAATAAGCCAATGAGATACCTTCATAAGCGTGAAGTTACGA
TGCAGATGACGCCAATTGGGTTTCTTGGTCCTTCAAGTGATTGACGGTGT
CCTCCCAGGTAGCGAAGGCCTCCTCAACCTTGCCTTGCAAAACCTCATAA
TTCTGGTAGTAGGCGGGATCTGAACTGGCTTTCTTGTAAGCTTCAGCATC
GGCTAATACTTTGTCCATGACATCGAGTTTCTCTTGCAGGGATCCGTAGG
CTTCTTCTGCCTTGTCAGCTTGTCGACGAGCCTTGTTAACAGCCTTTTCG
AGATCGCGAAGCTGTGCGCGCTGCTCCTTATGGCCAATCTTGCCGCTGTC
AACCTTTGCTTGCTGGGCAATCTCTGTCTTTTTGTCCAATTCCCGCATGC
TATCAAGCTTGCGTTTCTCCAGGAAATAAGCAATGCCACCAAGGTATTGC
TTGGCCTTACCGTCTTTGAATTCATAGGTCATGTCAGCCAATCCTTCAAG
GAATTCTCTGTCGTGTGAAACCAATATCAGTGTGCCATCGTACAAATTCA
GGGCATCCTTGAGGACATCCTTTGCGACCATATCTAAGTGATTGGTTGGC
TCATCAAGAATCAGCAAATTCATGGGGTTGAGCATCAGCTGACACAAGGC
CAGTCGGCCTCGTTCTCCACCGGAAAGCACCTTCACTTTTTTCTCCACAT
CCTCCTTTTGAAACATGAAATTGCCCAGCAGCTTCCGCACTTGGGGCCTC
ATATTTTCAGGGGCAGAATCCTCAATGGTTTGCAAGACAGTGAGGTTTCC
ATCAAGGACATCTGCTTGATCCTGTGCGTAGTAGGATAGCTTTACCTGAT
GGCCAAAAACTAACTCTCCCTCATGTTTTAGCGCTTCAGCCATGATTTTG
ACAAGGGTGGTTTTGCCTTGGCCATTCTGACCCACAAAGGCCACTTTTTG
GCCCCGGCTTAATTCCATGTCTAAGCCCTTCAGTACATGCTTCTCTCCAT
AGTGCTTATGGATGTTTTTCATGTTAACGACCACCTTGCCAGAGTGCGGT
GACGGTGGAAATTTGACACGCATTTGTCGCTTGTCCTCGTCATCCACTGC
GATCACATCCATGCGAGCCAACTGCTTAATCAAACTCTGCGCAAAAGCTG
CTTTGGATGCTTTGTAGCGGAATTTTTCAATCAACAATTTTGTCTGCTTG
ATTTCTTTGTCTTGATTGAACTTAGCCTGGCGTTGCTTTTCGCGGATTTC
CTCGCGCAAAACCAAATACTTGTAGTAGGGGGCAGGGTAGTCATAGGACT
TGCCCATCACGATTTCCAAGGTCCGGTTGGTGGCGTTGTTCAGAAAGGTT
CGGTCATGCGACACCAGAATGATTGCCTGAGGGCTTTCAGATAGGAATTG
CTCCAACCAGAGAATGGATTCTAAGTCAAGATGGTTTGTTGGCTCGTCCA
AAAGCAAGAGGTCATTTCTCTGCAGCAGGATTTTCGCTAACTCAACCCGC
ATTTGCCAACCCCCAGAAAAGGTGTCAAGTCGCTTGTGGAAGTCATCTGC
AATGAATCCTAGGCCCATCAAAACCCTTTCCATGTCAGCTTGGTAGGTGT
AACCACCAATGTGCTGAAAATGTTCCTGTGCCTTATGGAATCGATCAATC
AAGTCCATGTAACCCTGTGACTCAAAGTCCTCACGTTGCCCCATCTCTAG
GGTCATGCTCTCCATATCAATTTCAAGCTGTTGGATGTCACCAAAGCTTG
TTGCGCATTCATCCCATACGGTTCGCTCCCCCTGAGTGGGGATGTCCTGG
GTCAAAAAGCCAATCTTGAAATCTGTTGGCGTGTTGATTTGACCTTGGTC
CTGGCTCATCTCACCAGCAATCAGTCTCAATAGGGTAGACTTGCCAGCGC
CATTGCGGCCAACAAGGCCCAATCGCTGACCAGGGGTTACCTGGAATGAA
ATATCCTTGAATAGGTCGGTGCCGCCAAATGACAGGCCAAGTTGGTGTAC
GCTTAACATGGGTGGCAAAAGTAACATCCACCCCATGGTTTCAGAGTAAA
TTTGTGGAAATTCTATCAGACGGGCTATTGGGCCTTAAAATCCCGGTGTA
ACCAAGTAAATACCAGCATACCATGACATCACCTATTGGCAAAGGCAGCA
AGTTTTATAGCATCATCAAGGCAAAATGCCCTGCTTGCCATGAAGGCGAG
ATGTTCAATGACCCCAACCCTTACCATCTGAAGACACTAGCTGACATGCC
ATCTCATTGTTCAGTTTGTGATCAAGTCTACGAACCAGAACCCAATTTTT
ACTATGGTGCGATGTATGTGTCTTACGCCTACACTGTAGCCATTTCTGTG
GCCATCTATATCATAGTTGCCGTCTTCCTTGGGGTAGGGATGTGGGAGAC
CATCATAGCCCTGGGGGTGATCCTGGTTGGTTTTTCCCCCGTGTTATTCA
GGATTTCACGCAGTACTTGGCTGAATATCTTTGTCCACTTCAAGCCCAAG
GCGCAGCAGTGATCAGTTTTTTTGCCCAATAGGGTGCCGTCATAGCTCCC
CTTGACCCCAATCCATTGAGATAGCCTAGGTTGCTCTCAACGCCATGCCA
GCCCAGCCTCACGATGCGGTCTTTCATGGTTGGTCGGATGCCCACCCATT
GATCCACGACGCGCAGACCAGGCATAGAAAACCAAGGCTTCAAGCCATCC
AACAATTCCAGCCTGGCAGCCTTGCTTGGTGGGTCATTGAATTTGTCCCA
GCTATAAGTAGCGCCCAGTTTGGCCATGGAACCCCCTTCGGGCAAAAGGA
AATGGCTTTGATGGTAGGGGTGATGCATGGCCTCGCCATCCCATGCGATG
GTCAAGCCTTCTCCGCGTGAAGCGGCAAAGGGCAATTCACCAAAAAAATA
TTTTGTCCATTGGGCTTGAACCCCTTCTGCAAGGATCAAGGCATCCACCT
TGTGGCCAGAGACCATCCAGCCTTTCCCTTCTCGTTCAATGTGGTCAACC
TGCCCGTGGATCAATTGTTCGCCAAGGTGCGTTGCCATGGCCTTCAAGTA
GGCTTTGCTGTGCAATCGTCCACTATGTTGGACTTGTCCCACATGGCTAT
GCTGAATCCCTTGATGATCTGCTTCATGGCATGGTCCTATGAAGGGTTTT
AATGCTTTAATGTCAGCCAACTGTCCCCAATCCTCCGTTGCTTGGCTGCC
AATGAGGACTTCCCTGATGGAATCCATATTCAATAGGCCTTGACCCAGGC
TGGCCTCAACTGATTCGTAGTAGGTCTGCATGGCATTCAGATGCATCTGT
GCCTGCTGTACCACCTTTCGACGCCGTAAGGTGACAGGATTGATTAAGCC
AGAAGCCATCCATGAAGCTGATTGCTCAATGCCCCGATCAAACACAGTGA
CAGCATGGCCCACTTGCTGCAGTTGCCATGCCAGTGCGCTGCCGCCAAAG
CCTTGTCCAATGATGCCTATGTGCATATCCTTCAATTGAGGTATAAAAAA
AAAGGCCGCTTTGAGCGGCCTTTCAATGGGGTTGACTAGAACTGCCAGAG
GTCATGTTCGTAGTTGCGAAGCTCCTCACGGATTCGACGCGACTCAAGCA
GCTGATCTAATGGGCGGCCATTCTTGTAATCTTTGATTCCTCGATCGTAA
ACATTGTTCTCCTTGTACACCACAGCATTGAAGTAGCGCATTTGGAAAAT
CTGATCAAAGGTCATGCGACGCGTGTTGTTCGATGGGTTGTAAGCTACAT
GTGTACTCATAGCCTGTCGAGCGTCAGGGAACCAAATCCAAAAGGTCGGG
TAGATTTCACGCGTGCTTGGGTCTTCCACCACAGGTGAAATGCCAATGAT
GCGATTCTTCATCTCACCGCGTTTCTTGTCAAAGTACCAATCTGATTTGA
TCTCCCAGTAACGCAAATCTGGTGCCTTGATTTCAATGGAATCTATGCCA
AGAACGATCGATGGATCGTCTGGATCAAGGATGGTGTCAACACGGAATAG
AATGTCAGCCACCTCTTGTGTGGTCAATGGCATCTCAAAGCGATCGTCCA
CAAAGACTTCAGAAATAGTTCCTTCAGTCAAGATGGCATCCTTCAACACG
TCAAACAAAGATTTTCTATCTGGCAATGCCTTTACTGGGTAGTAAAGTGG
ATGGTTGAGTTTCTCTTGAACCTGAATGCGCTCCCACTGACGTGTGGACC
ACATGATGTCATCCTGACGGATGAAGCTGTAGGGAATGACTCTTGCGTTT
GCGGCGTGCAACTCTCTTTTTGGAGTCAAGCCATCATCCTCAGGGGTGAT
GACCTGTCCTGTGGCAAATAAACTGCCAACAAGGATGCAAGTGATGAATA
GATGCTTCATGTTATTGTACGTCGATGGTTATTGGACTGATTTTGTCCAA
GCGTGTTCCTTTCGGTGTCTTGGCTTTAATCTTCCTGATAATGACCGTGC
TTCCTGGACGGAGGCGCGTGATGCGCTCACGGTATTTTTTCTCAATGCGG
TCGCCAGTGATTTTGATGGGGGCTTGGCCTTCCAGTTTCAATTCAAAGCT
TACCACTGTGAGGGCTAAATCGAAAGGAAAGTCCCGGTATTCAGCTTCAA
CTTTCGCTTTGCTAAAGAGTGAAGATGACATGACACCTTCCGTCTTTTTG
TATACAGAACCCATAGCTTGCGGCAATCCCTTGATGCGGAATTCTTTTTT
GCCAGCAGAGCTAAGTTTGCCATTGGCTTGACGTACGCTTACAGAAATGG
TGAGGAGCTTTCCTTTGATCTTGGTAACATCAGCCATGTACTTGCCATTG
CTGCCTGTAACACCAGGGCCATTGACGACCAAATCTTTGGGTGCTACGCC
GGGAACAGAGACTTCCAATGGGTTGTCCACGTTTCGGTACAACACATTCA
TTTTTGTTGGTGAGATTACCACTGTTGGAGGCGCAACCGTGTAACTGAAG
CTGATGGGGTATTTGGTGTCAGAGCCTGGCAGGCTCATGTTGCCTGAGAA
GGTTTTCTCACCTATGCCACTAGCTTTCATTTTGAATTTACCTACACCTA
AGTTCACAGAGTCCATCTCAATGTCTTCAAAGATTGGGTTACGCTTTTGG
TCAAACGCTGCAAGGAAAATGTCAGCCTCAAAGAAATCGCCTTGGGTGAC
AAAGTTGCTTTTGGGGACTACAACTGCACGAGCTGCATCAAAACGGATAG
TGTTCGCATCAATGTTTGAGTACAAATGCTCAACAATTTTAGCTTCCATG
CGTCGGACACGGGATTGGTAATCGGTCATGAAAGGTATAATTCCAGCCAA
TGGCAATTCGCCAAATGTGGCGCGCTCCCATGACTCTTTGGTGCCATCTT
CCGTGACGTCATTTAGATCAAAAGTGGCATCTAAAGCAGCGATTATCTCC
TCATCACCATCTGCCTGAATCTTCATGAAATCTTTGAATGAAGAAAGGGT
TTCCTTGATGGATTGACCCATGCCTTCACCCCCAATAGCCTTAGCATTAA
GCAAGTAGTTTTCTGCGTAATCCCTGTTGCTGGCACCTTTTAGGCGACCA
GTTTCCGGGTCACGTCCACCGGTCTCTTTGATCAAAGTAAGCTTGGCCTC
CTTCAGCATGTCAAAAATCTCGGATGTTTTCACCTTGACTTGCTTAGCCC
GGTCATTGAACTCAATGGCACGTGGGTTGTCAACAGTTGCATTGTCCAAA
GCTGTGTACAGGGTTTCTGTACTGCGATGCACGGTCTTCACAGTCTCTTC
CATGCCGGAATTCAGCTTGTGAAGTACCTTTAAGATGTCCTGTGATACAT
TAAGGGCAAGCATTGCCGTCAAGACCAAGTACATCATATTGATCATCTTT
TGTCTTGGAGAAAGTTTTCCTGATGCCATCTTCTGAACTTAAGGATTGAT
ATTTTGAGAGATCGAGTTTGCTTAACTGCGATTCAAATTCATGGCAGCAA
GCATGTTGCCATAGACTGAATTCAACTGAGTCAAGTTGCCAGCCATCTTT
TCAACTTCTGTAGCCAAGGCTTCAGATTGTTGTCCAGCACTGCCCAATTT
CTCCATCAAGTTGTTTTGCATCTCCATCTGGTTAGTGGAGTTTTCTAATT
GTACTGAATACAAAGCGTTCAATGCCTCCATGCTTTTCGCTGCTTCAGTG
AGTTGCTCAGAGTAGGCAGCTGATGCACCAGCAGCATCGGCTGCATTGTT
CAAGGATGCAGCTGTATCACTCAGTTTTCGCATGCCATCACTTAAGCTGT
CAATCAATTCAGGTCCAATCTTAGCTTCAGCCATCATTTTATCCAACTCC
TGGGTCACGGTGCCACGTGGTCCATTGCCAGAACCTTCTTCATCAATCGA
TAATTCAGGGTATATCAAGCTCCAGTCGTAGTCCTTTGCTGGTGCCTCAA
AAGCAGAAATAAAGAAGATCACTGCTTCTGTGGTCAAACCAATAATTAGC
ATTTGGTCAGCACCTTTGAGGTGAAGAATTTTAAACAAAGCACCAAGAAT
AACAATTGCAGCACCAATACCGTAAAGTTTGGCCATGAAATTCTTGAAGC
GTTTTCCGTTGACGTTAATTAGAGCCATGAGGATTGAGTTTAGAGATTGG
AGTTATGTTAGAGGAGGTCGGTTAAAAGTCAGATGCATCGCGTCCAAGGA
AGCTTTGCACGGTTCGGAAGCCAATGAATGACTTGCTTGTGTCTTGGTAT
TCATATTCACGAGCGCCTACTTGCATGTAAGCAGCAATGTCCTTCCAAGA
CCCACCGCGAATCACTTTGCGCTTTAGCGTTTCAGGGTCAGAGTCATTTG
CGTTGTATTTGAAATCTGGGTTGAAGTCGGCCACATAAGCATAACTCACC
TCATCCCACGCTGTGCTTGTCCACTCAGCAACATTGCCGGCCATGTTGTA
CAAACCATAGCCATTGGGCTCATAGCTGGTAACCTTCAAAGGATGAAAAC
CGCCATCTGCCGTCAGGTTGCCGCGTGAGGGCTTGAAGTTGGCAAGGAAA
CAGCCTTTGCTGTTAGTTGTGTATGGACCACCCCAAGGGTAAGTTGTGAG
CTCACGGCCACCGCGGGCAGCGTATTCCCACTCAGACTCTGTAGGTAAAC
GGAATTCGTTTTCCTGGAAGTCTTTGTTACTTTTCAAGTAGCCATTGCGG
TAACCTGTTCTCCAGTTACAAAAGGCCATGGCTTGCTTCCAGCTGATGCC
AACTACAGGGTAGTTGTCATAGGCAGGGTGCCAGAAGTAGTTGTCGTGCA
TCTGCTCATTAAAAGAGTAGGTGAAATCAGCCAACCACACCAAAGTATCT
GGGTAAATGTTCACGGTCTCAGAACGGAAGAAGCTGCTACGATCTGATTC
AGCCTGCCCTTCTTTGATATAATCGCGGTAGGAGAAGGTGCGTCCATCAC
CATCTGCGTCATTGAAGTCATTACTGAAGCGATTGTCTTTGCTTGCAGCA
GCCTTCTTGTCCATCCAGAAATAGAGGTAGTTCATTTGACGAGCATCAAG
CATACGGCCACCGAGGTAGCGCTCTTCCGGCGCGAGATACATGGTCTCCA
TTACTTCAGCATACTCCAAAGATGGGTAGCGACGCGTGGTCCACTCTAGC
TTGCGCCCCCAGTCTAAATGCGTTTGCATGGAATCAGGGTACTCAAGGCC
AACGTACTCTTCAAAGTAGGTGGGGTTGTTCATGTCCGTGTAATCAACGT
ACTCAAATTCCTCAACCAAGCCTTCAGCCAATCGGTAGCGTAAAATGGAA
TCGCGCACCCAACGAACAAACTGTCGGTACTCATTGTTAGAAATTTCGGT
TTCATCCATGTAATAGGGAGAGACCGAGACGGTTTTGGTGGGCGCAGTCA
ATGTGACAGGCACATCAACATCTGAGTTACCCATGTTGAATGAGCCCTGT
GGAATGAAAACCATGCCATAGGGGTCAGAAGGGTAGAAGTCGGGGCGGTT
TTGAACGCCAACAAGCTCGCCGTGATCAGTTCCGGAGCATGCCGCAAGCA
GCAGGACGGTAAAAGCCGACAGGAGTTGTTTTAAGTGCGTGGTATTCATA
TGCTATCTAGTTAACGTCTAAATCAGTTGCGATATTACAAAAATATGGGG
TTTCGGTAACTACCATTGATGCGAGGTTTTACCTCGATGTTGAAACAGTA
ATTGAAAAAGACCTCATGCGAGCCTGAAGAATAGGCGGCAAGCGGAGAGG
TTGTAATGTCGTAGGAGTAGCATGCGCGTAGGTCGGGCATGATTTGGTAG
CCCATCATAAGGGACAGCGCATCCTGGTTTCTGTAGCCCAATCCAGCGAA
TATTTTACCCCGCAATTCTGCAGTGAGACTGAGATCAACAGTAAGGTTGG
AATTTAAATCTGACTTGAGCAAGGTGCTCGGTGAGATGGTGATGCCAGAA
TTGGGCAATTCAATGTGCATGCCGCCAGTGAGGTAGTAATGCATTTTGCT
TTTGTAACGGGCAGTCTGTCCGGGGAATCGCGCCTCACTTTGCAGCATGC
GGCTTGTTGAAAGGCCTGCGTACCAAAGAGGTGTGCCGTAATGCATACCA
AAGTTCAATTCTGGGGTCATTGCATCGCCAGCCCTTAGAATGCTAGGATC
TGAAGCTCCAGCCGTTCCATCGGGGTAAATCCAGTTAGCGGTCTTGACAT
TTTTGTTCCTGAAATCGATAGCCAGGCCAATTCCAAGCTTGCCAGCACCT
AAATCCATTTGGTAGGCATAGCCCAAGGCCGCAGAAATATCTTGAAATAC
CCCAATTTGATCATTCACAATGCTAACAAGCAGTCCGCCGTGTAGAATGG
AGAGGGGAATATTGGCATTTATCGCCTGTGAAACCGGCGCGTCATCAAAG
CCAACCCACTGTGATCGGTTACCCAAATTCAAGCATATGGCATCAGAATA
TCCTGCTACGCCAGGGTTGAATCCAATCTTATTGTTGTAGTACTGAGTGA
ATTGCACGTCCTGCTGCGCAAATGCTGCGCTGCTGATGCAAATCAATACT
CCGGAAAAAAATGTCTGACGTAGGGTCATTCAGGCATGAAATTAGGCCTC
TAAAATAACAATAATCTACCAGAAAGTAAAGATTAATGTTAGATGGCACG
CCGACTGGCCTTCCACCAGCGGTCGGGAATGTCACCTTGAAGCGCTTGAA
GGTAATCCTCGTGACTGCATGGAATCATGCTTTTCCTTGCCGATTCAGAT
GGACTGGCAGGGACAACCATCCACCAACGCTCTGACAGTGGTGATTTATA
GAAGACCATTTCATGCCCTTCATCCCCTTCCAGCCAGACTGTAAACTTGA
GGTAGTCCTTCACTGGCCGATGCGGGTAATCGCCTTTGCGCCATTGAATG
CCTTCAGCGATGTACCAGATGCCTTGCGCTAAGGCCATGGCGTTGTGCCC
ATGCGGGTCAAGTGTTGGGTGATAGCCTGTGAGCATCAACGATGAGGATT
TGTCGCTCATGCCTGCGTAACGCATGGCTTGACAAAAGTCCACCGAGCTC
AGGCCGTTGGGGTTGGGGCTAGTCTGCCCGGCGGCGTCCACTGATCCCAT
GCTGGCGTTGTCTGCAACAATGATGTCCATATCGCGAAGTAGGGGCTCTG
CCGCCGCCATGGAGCCTTTAATTTGGCCAATTCGGAGGGCCTCAAAGTGC
ATTTTTTCCATGATGGTCAAAGTTTCCTCTGGCACGAAATAGGTTTGGTA
GGCCAGGCAAGCCAAGTGGAAAAGGTGGTAGGGCTTTGACATCAATACGT
GGGTGAGCCAATTGCTGGCATCTGCCGCTTGGTTGTCATCTCCCATGGCG
ATGCCTGAGCTGATCACAGCCATGTTCACCAATTGCTCAAGGCTAGCGTA
AGCCTTGTAAAGGCCAAGTGCGTCTTGACTTTGTCCGCCAATGAAGATAG
GAATGCATTGCCGCTGGATGAGCTCTTTCGCGACATCCTCTATCGCAACC
AGGGTGTCAACATGGTCGCGCCCTGCAGGCACGTTGCCCAAGTCAGCAAA
GTCAAAGTCCCAAGCACCCTTTTGCAAGGTGTAGAGCTGTTGACGGATGG
CATTGGCTGCCTGGTGTTCGCCATTGGCGTCAGGTAGGCCGATCAATGCC
AATCGGCACGCCTTCACATCAGGCAAGCCATTGGCATCATGCATCATCAT
GGTTTGACCGATGGATGAAATGTCCTCAGGAAGCAGCAGGTCAGCAGGTT
GAAGAATATCCTCCCACATCACTTCTTGGCTTTACCCTTGCGGCCTTTTT
TTGGCTTGGATGCAGCCTCCTCAATCAAGGCCAGTGCTGCTTCATAAGTC
AGGCTTTCGGGCTCCACATCCTTGGGGATGGTGACATTTTTCTTCTCAAA
CTTGAGGTAAGGTCCATATCGGCCATTGAGCACGCGAATTTCGCCTTTGT
CACCGTCCAGGGTGGCAATATTTGCCTTGCGATCTGCTTCAAGCTTGGCC
TCAATCAACACCATGGCCTCTGTCAGGTTGATGGTGTAAGGGGATTGCTC
TTCAGGGATGCTGGCAAAGGTTTTGCTCATCTGCACATAAGGGCCAAAAC
GGCCTAGGTTTGCTTTGATATCAACGCCTTCATGGCTACCAAGAACCCGT
GGCATCTTCAGTAACTCTAATGCCTCATCCAAAGTGATGGTTTCAATGGA
AAGCTCCGCAGGGATGCTGACAAATTTTGCTTTTTCCGTTTCAGTGGTTT
CGCCCACCTGCACTACAGGTCCATAGCGGGCCAGTCGGGCAATGACTTTT
TTGCCAGTTTTTGGCTGTTCACCCAGGGACCGTTCCCCTTTCTCTGGATC
CACGTCCTTGGTGATGCCAACCGTTTCAATGAATGGCTTGTAGAACGAAT
TGATCACCTCAGTCCATGATACCTGGCCGCTAGCGACCAAGTCAAATTCT
TGTTCAATATTTGCAGTGAAGGCGTAGTCCATCACCGTGTCAAAATGGCT
AATCAGGAAATCAGTAACCACATTGCCAATGTCCGTAGGAACCAGGCGGC
CCTTGTTGGCACCAAATTTCTCTTGAATCACTTCCCATGACCAGCTGCCT
CCTTCAAATGAGCCTATGGTCACATCGCGAACCTTGCCGTCCAAGGTGCC
TTTTTGCACATAGGCGCGCTTTTGGATGGTGGTAATGGTTGGGGCATAGG
TTGACGGTCTGCCAATGCCTTTTTCTTCCAAGGCTTTGACCAAACTGGCC
TCTGTATAGCGACCCTTGGGTCGGGTGAAGCGCTGACTGGCTTTTGCGCC
AAGCAAAGTCACGTTGCCACCTTCAATCAATGCGGGCAGCAAGCCTACTT
CAGCTTCTGACTCATCCTTGCCCTCGAGGTATACTTTCATGAAGCCATCA
AAGGCCACCATTTCGCCTCGGGCCACAAACCGAACCCCGCCTTGGTTGTC
TAAGTGAGCTACGGTGCGATCAATTTTTGCATCAGCCATCTGGCTGGCTA
AGGTGCGTCGACGAATCAAGGTGTACAGTTTCTCTTCAGCCTCATCATTG
CCACCAGTTTTGATCGACAAGTCTGTTGGGCGAATTGCTTCGTGAGCCTC
TTGTGCACCTTTAGATTTGGTGCTAAACTTCCGCGTGTGAACGTAATTCT
CACCGTAGGATTCTGTGATGGCTGCAGCAGCCAAGCCAAGGGCTTCCTCA
GATAGGTTCACGGAATCTGTCCGCATGTAAGTGATCAAACCAACTTCATA
AAGTTTCTGAGCAACCGACATGGTTCGGTTCACAGAGAAACCCAATTTTC
TTGAAGCTTCTTGTTGGAGCGTGCTTGTGGTGAAGGGGGCAGCAGGCTTT
CGAGTGCCAGTCTTCTTGGTCAAAGAAGCGACATGAAACGGGCTGGCTTG
CAGGTTGTCAAGCTGTGCTTGCACGGCGTCACTATTTTCAGCTTGACCGG
ACCAATCGGCCTTGAAAGCTTCACCTTCTGCATTGCTGAATTGTCCTTCT
ACTTTGAAATCGGTGACAGGAACAAAAGCATGGATGTCACGTTCACGTTC
CACAATCAGGCGAACGGCAACGGACTGCACTCGTCCAGCGCTCAACCCAC
TTTTCACCTTGCGCCACAAGATGGGTGAGAGCTCAAAGCCAACGATGCGA
TCTAAGACCCGTCGGGCCTGCTGCGCATTGACTAGGTCCATGTCTACATG
GCGAGGGTTCTCAATGGCACGGGTGATAGCTTTTTTGGTGATTTCGTTGA
AAACAATGCGCTTGGTTTTTGCGGGGTCAAGCGACAAGGCCTCAGCCAGA
TGCCATGCGATGGCCTCTCCTTCACGGTCTTCATCGGACGCGAGCCAGAC
GGTGTCGCAAGACTTCACCCATTTTTTCAAATCGCGAACAATGTCCTTTT
TGTCCTTGCTGATTTCATAATCTGGCATGAAGTGATTCTCTATATCAATG
CCCATTGAATTGCTACCACCCTTGGTTAAATCACGGATGTGACCAAAGCT
GGAGGCCACCTTGAAATCAGGGCCTAAAAATTTCTCAATGGTTTTCGCCT
TAGCAGGCGATTCGACGATAACTAAGTTAGATGGCATACTCTCGGGGTTT
TGAACCGCAAATTAAACCCCCAATTCCCATATAAACACGTAAAATTTTAC
TTCTGCCATTTTGTCACTTGGTCCGGACGTAGTCCGTAGATTTGCCAAAT
GGAACAATTGTCAGGTGAAGTAAAAGTCATGATGGAGGAAAACCGTCAAG
GTGAAGCCATGATCAAACCAGGGGTTGGAAGTAAAAAGCTCTACCTGGAA
AGCTACGGTTGTCAGATGAATTTCTCTGATTCAGAAATTGTGGTATCTAT
CTTGGACAAAGAGGGTTACGAGACCACATCCGACCCTAAAGAGGCAGATT
TGATTTTGCTTAATACTTGCTCCATACGCGACAAAGCAGAGCAAACCGTG
CGCAACCGACTCAAGCACTTCAAGCGCATTAAGCGTGAAAACAAGGATAT
GAAAATCGGTATCCTTGGTTGCATGGCAGAACGCGTGAAGGCAAAATTAT
TGGAAGAAGAGCAATTGGTGGATTTGGTTGTTGGACCTGATGCTTACCGC
GATTTACCCCAGTTGATGAAAGAACTTGACGGTGGGAAGAAGGCTATCAA
TGTCCTTTTATCCAAGGATGAGACCTACCATGACATTGAGCCGGTCCGGC
TGGGCGGCAATGGCGTCACTGCTTTTGTTTCCATCACCCGTGGCTGTGAT
AACATGTGCTCATTCTGCGTGGTGCCATTCACCCGTGGCAGGGAGAGAAG
TCGCAACCCACAAACCATTGTTGTTGAATGCCAGAAGCTATGGGCTGACG
GCTACAAGGAAGTGACATTGCTTGGTCAAAACGTGGACAGCTACCTCTGG
TACGGCGGTGGGCTGAAGAAAGACTTCAAGGTGGCTAGTGACATGGCCAA
GGCCAGTGCTTTGCAATTCAGCCATTTGCTTCACATGGTAGCTAACGCCT
TGCCTGAGATCCGTATTCGCTTTGCCACATCTAACCCGCAAGACATGTCT
GATGATGTGCTTCGAGCCATCGCGGAACATAAAAACATTTGCAAATACAT
CCACCTGCCTGTGCAAAGTGGATCCAGTCGCATCCTCAAGGCAATGAACC
GTGGCCATGACAGGGCCGACTACATCGACTTGATTGATCGTGTGAAGCGC
ATCATTCCCAATTGTGCGATTTCTCAAGATATCATGTCAGGATTTCCGAC
AGAAACAGAGGAAGATCACAATGAAACCTTGAGCCTTATGTCCCAGGTGA
GGTATAATTTTGGCTACATGTTTGCCTACTCAGAGCGGCCAAATACCATG
GCTGCAAGAAAGCTAGAGGATGACGTCCCCCTTGCAGTGAAAAAGCGACG
CCTGCAAGAGATCATTGACCTGCAGCAAGTCCATAGTGCAGAACGCAATG
CGGCAAATGTTGGCCAGGTGGTAGAGGTTCTGATAGAAGGGTATTCCAAG
CGGTCTGACAAGGATGTCTTTGGACGAACCAGCCAAAATGCCGTGGCCGT
TTTCCCAAAAAAACACCATCTGCCTGGTGACTTGGTGAGCGTCTTGATTC
GTTCAAGTACAGCCGCTACCTTGTTGGGCGATTCAATTGATACCCCGTTA
TGAAACAGTTCCTGTTGATGCCTCTTGTTTTGATGGCTAGTTTGTCTGTG
CAAGCACAGGTTAAGTCATCCCAGCAGCCCTTGTCTACCATGTCTTTGGT
GGATGAGTCACTGCATTTTATGGTAGTCGATGAGGCCATCAAGCAGCAAG
GCACATTGAGTATTTGCATTGCGCAAAAGAATCGCTGCATTGAGAATCTG
CAAGTCGGTTTCATTGTGCGGATTTATGATGCCAGCGGTCAAGAGATATG
GAACTCCTTGTGGTCAGGGAAGCATATGGATATCCGATTCAAATCGCCGA
TACCACAAGCTGCGACCTATGCAGTTGAAGCAACCTCAGATTTTGTCATT
AATCGCTTGACAACCAATCGGATTTCCACAGTCAAACCCATGCAGTTGAA
CCAACCCACTCAGCCATGAGCCCCCAAGAATTGAAACAACGATTTGGTAT
CATTGGTCAAGACCCGGCCCTTGATCGCGCCTTGTTCAAGGCCATGCAGG
TGGCAGCAACAGACATATCTGTAATGGTCACTGGGGAGTCAGGTGTTGGC
AAGGAAAGCATTCCTCGTGTTATTCACAATTTGTCTCATCGCAAGCACGA
GTCCATGATTTCCGTGAACTGTGGCGCCATCCCTGAAGGCACGATGGACT
CTGAGCTGTTTGGTCATGAAAAGGGTTCATTTACCGGCGCTGTGGGTGCC
AGGAAGGGCTATTTTGAGGCCGCAGACGGCGGAACAATTTTCTTGGATGA
GGTAGGGGAGCTTCCTTTGGCGACACAAGTGAGATTGCTTCGTGTGCTTG
AAACCGGCGAGATCATTCGCGTGGGCTCCAGCAAGGCCATGAAGGTGGAT
GTGCGTGTTGTGGCTGCAACGAACGTGGATCTGGCAGAAAAAATTGAAGC
TGGAAAGTTTCGAGAGGACTTGTTTTACCGACTTAATACGGTTGAGATAA
CCTTGCCGCCTTTGCGCGAGAGAAAAGGAGATATCTACCTGTTATTCAGG
AAATTTGCGCAAGATTTCTCTCAAAAATACCGTACACCTGCAGTCAGGTT
GACTGAGGCGGCTGTGACCGTTTTAGAGTCCTACCGCTGGCCGGGTAATA
TTAGACAGCTGCGCAACTTGGTGGAACAAATTTCTGTCATTGAAGGGGAT
CAAACCGTTGAGGCCAGCCTCTTGAGTCAGTACATCCCAGATATTGAGCA
AAGCAATTTGCCGGCGAGGACTTCTGGCCCGGTCTCGCAAGACCAGTTTC
ACAATGAACGAGAGATTCTCTACAAGGTCCTGTTTGATATGCGAGCAGAT
ATACAGAATCTCAAACACTTGGTGGGACAGATAGCGCAGGGTGGGCAGTC
CATGGATGACCTTTCTGATGGCATTCAAAACTTAGGCAACAAGATGCAGC
ATGACATCACGACTTTGCCAGCCCTATGGAAGCAACCCGAGCAGAAGGAG
TCTCCGGCCACAAGTGCGGCAACTGAGGAGGCTAAGCCAGCGCAATCGTA
CATGGATATTGAGTCTTTGGATGGGAATTCTTCAGTCAAAAGGGCCTTTA
AAACCCTTGAAAACATTGAAATAGAGATGATCAAGGATTCCATTGCAAGG
CACAAGGGTCGACGCAAGGAGGCCTCTGCTGAGTTGGGCATTTCTGAGCG
CACACTCTACCGTAAAATCAAGCAATACGACCTGGGATGAGTCGATTCAA
AGCAATGACAAGTTTATTAGTAAACGCATGGGTTGGCTTATGTATGCTTA
CCATCATAGCAAGCTGTTCTGCTAGCTATTCCTTTACTGGAGGAGATGTA
GGTCAGGCTAAAACCCTGTCTGTAACAACCATGATCAATGAATCGGATTT
AGTAAACCCCCAGTTGGCACAGCTGCTGACAACCACGTTGCAAGATGTGA
TGGCTAGACAGACGCCTCTGGACCTGATTGTAAGGGATGGAGATTTGCAA
TTCTCAGGTAGAATTATAGCGTACGATGTGCGATCTGATGCCCCAGGTGC
TAATGACCAGGTGGCGCAAAGTCGCTTGAGTGTGAGCGTTGCCATCGACT
TTATCAACCTGTTGGATGATACGAAAAACTTCAAGCAATCCTTCAATGTT
TACAGGAATTTCCCAGCCTCACAGACCCTGTCTCAAGTAGAGGATGTCCT
CGTGGATGAGATAGTTATGGAGCTCTGTGAGAAAGTATTCAATCGCGCCC
TGGTCCAATGGTAGCAAACCCTCAGCAAGTAAAGGCCATCCTTGGTCGTG
TGGATGAGTTGACTACCTCGGACAGTGAGTTCCTGGAGGGTCTTGTCAAG
CGATATCCTTATGCTCAGGTATTTCAGATGCTTCACCTCAGGGGCTTGCA
GCTCAATGAATCCTTCAAGTTCCCTCAGCAATTGCATCGCACATCCACAG
CCATGCTTAACCGGGAGAAACTCTTTACATGGACTGAGGCGCCGTTGATG
CCTATGGAGGTTGTTGAAGCGGCTGCCCGGATAGATTCAGGCCCAATTCA
ACTGCCTGAAGAGGCTCCTGCCTCATCTGCCCCCGCGCAAGCATCAGTCG
ATCCAGCCATTGATGTTCAACCTCAGGAGGAGACAAGCGCCCAAGCAGAT
ATTTCAGCAATTGAATCAGCAATTGAGCTTCCCACAGAGCCTGAAACTTC
TTTGCCTACTGTCATGCCGATTCAGCGGCTTTCAAGCATCAAGCCTTTGG
GCGATTTGTCTCATCTGCCTGAGATGGTCAGAAAGCAAATTGAACGCTCA
CGCGCCATTCAAGCCAGCCGACAGGCTCCACCTACACCCTTATCCAAACC
AGATTCGGCCAAGCAATCACAGAAAGTTGTTCTTCCAAAAGCGACAAGTC
CTGTTAAGCCAGTTGAACTTCCTAAGCCAGCTGAAGCCCCATTGCCTATT
GAGGTAGAAGTCCAGCCGATTACCGAGTCGGCTCCTCAAGCTTCGCCTCA
ATCAGTTCAATCAAAAAATGCGACAGATGCCCCCGCTGTCACCGCAGTTG
TTGATGACCTATCGACCTCACCAGTATCTGGCTTGTCGAAAGTGAGTCTG
TCACCTTTTGCGCAATTCCTTCATGGTCTTCAAACGGAGAATCAGGCACA
GGTTGCAAGCACAGCAGCGCAGTTGAGCCCTCGCAAGCGAAACCCCGCAG
AGGAGCGAAAGATCCTGGAGTCATTCATTGCAGCCAACCCATCAATGCCT
GCACTGAAGCCTGAGGCAAATACTCCGGGTTCAGATGCTGCCTTGACCAA
TGTAACAGGCCTTGTGACAGAGACCCTGGCCAACCACTACGCATCCCAAG
GCTTGGTTCAAAAGGCCATTCAAGCCTATGAGATATTGAAGTTGAAAGTT
CCCGAGAAAAGTTCCATCTTTGCGGCCCGCATTTTGGCGATGCAGCAAAC
CAAAAAAAACTAGACCATGTCCACGCTATTCATCATACTTATCACCATTG
TCAGCATCCTTTTGATTTTGGTTATCCTTGTGCAAAGCCCTAAAGGCAGT
GCGTTGGGTTCTGCTTTTGGTGGTGGTGCTGCTGCTGGCATGCTCGGCGG
TGTTAAGCGCACATCCGATTTTCTTGAGAAGGCAACTTGGGTGTTGGTTT
CTGTCCTTTTCGGCTTGGTTCTTTTGATGAATGTCATGGTCGGTGGAGGC
ACTGCTCAATCCCTGGATCAAGAGTCCTTGCTCAATCAGGAGCTGGATAA
TTCAGCCCCTGTTTTCCAGACGCCAGCCAGCCCGATTGAGGGATTGGACT
TGTCTGAATAGGTTGTAAAACCATCCCCGCTGCTGACAGCTTGTCAGTTT
TATTGGCTTTCTTATGTTTTGGCACATTCTGTGCATAGTTTTGAAGTGAG
ATTTATTCTCTTAACCCCTATTAAAGCATACCATCATGGCAGACTTGAAC
ATCCGTCCCCTGGCAGACCGTGTCATCATTGAACCGGCTGCAGCTGAGAC
CACCACAGCTTCAGGCATTATTATTCCTGATACAGCTCAGGAGAAACCAC
AGAAAGGCATCGTTGTTGCCGCAGGCAATGGCAAGGTTGACGAGCCAATG
ACCGTGGCTGTTGGCGACACTGTGCTTTACGGCAAGTACGCTGGCACTGA
ATTCAAATTTGAGGGTGAGGATTACCTCATTCTTAGAGAGTCAGACATTC
TGGCCATCATTTAATCATCTTATTTAAATACCTATTATCATGAGTGCAAA
AGAAATCACATTTGATGTTGCTGCACGCAACGGACTGAGAGCAGGCGTAG
ACGCCCTAGCTAATGCAGTGAAGGTCACATTGGGCCCCAAGGGTCGCAAT
GTCATTATCGAAAAATCCTTTGGCAGCCCTGTTGTCACCAAAGATGGTGT
AACCGTTGCAAGGGAAATAACCTTGGAAAACAAGTTGGAAAACTTGGGAG
CACAGATGCTCAAGGAAGTTGCTTCCAAAACAGCAGATGTTGCTGGCGAT
GGGACAACCACAGCTACGGTTTTGGCTCAAGCCATCATCAAACATGGCCA
CAAGAATGTCATGGCAGGTGCAAACCCAATGGACCTCAAGCGAGGTATTG
ATAAGGCTGTTGCAGTTGTTGTGAAGGCGCTAGCAAAGATGTCAATTGAG
GTTGGTGAAAGCAACGATAAGATTGAACAGGTTGCCACCGTTTCCGCCAA
CAATGACCCCTCAATTGGTAAGTTGATTGCTGAGGCCATGGATAAGGTGA
AAAAGGAAGGTGTGATTACCGTTGAAGAGTCAAAAGGCACTGAGACCTAT
GTGGATGTCGTTGAAGGCATGCAGTTTGATCGCGGTTACCTGTCCCCGTA
TTTCACCACCAACACTGAGAAAATGGTGGCGGATTTGGAGAACCCTTATA
TTTTGATCTACGACAAGAAGATCAGTACGATGAAGGAGCTCTTGCCTGTA
CTTGAGCCAGTAGCTCAGTCCGGACGACCATTCCTTATCATTGCTGAAGA
TGTAGACGGAGAGGCCCTTGGCACCTTGGTAGTGAACAAGATTCGTGGTT
CCCTGAAAGTGGCTGCTGTGAAGGCGCCAGGTTTTGGTGATCGACGCAAG
GCTATGCTAGAAGACATTGCTATTTTGACCGGTGGTACCGTGATTTCTGA
GGAGCGTGGTTTCAAGTTGGAAAATGCCACTTTGGATATGCTTGGTACCG
CAGAAAAGGTGACGTTGGACAAGGATAACACTACCGTAGTCAATGGTGCT
GGCAACAAAGATGACATCAGTGGACGTGTTGGACAGATCAAGGCACAGAT
TGAGACGACGACCAGTGATTACGACCGTGAAAAATTGCAAGAGCGATTGG
CAAAGCTTGCCGGCGGTGTTGCTGTGCTTTATGTGGGTGCAGCCTCTGAG
GTTGAGCTCAAAGAGAAGAAGGATCGTGTAGATGACGCTCTATCTGCCAC
AAAGGCTGCCATCGAGGAGGGTATTGTTCCCGGCGGTGGTGTGGCCTTGG
TTCGCGCCATTGAGTCATTAAGCAAACTAAAAGGTGAGAACGCTGATGAA
ACAACAGGGATTGCCATCATTGCACGTGCTATTGAAGAGCCATTGCGCCA
GATTGTATTGAATGCTGGACTGGAAGGTTCTGTGATCGTGTCTAAGGTCC
GTGAGGGCAAGGGCGATTATGGCTTCAATGCAAAAACTGACAACTATTGC
AACATGCATGAAGCAGGCATCATTGATCCAACCAAGGTGACCCGTGTGGC
ACTTGAGAATGCCGCTTCTGTGGCGAGTCTCTTGCTGACAACTGAGGCAA
CCATTGTTGAAATACCTAAGCCTGAGCCAGCCATGCCTGCTGGTCCAGAC
ATGGGAGGCATGATGTAAGTCAGCATAATCAAACAAAGAGCCGGTTCATT
AGAGCCGGCTTTTTTATTGCACGTAGGGCCTGTCTAGTCAAGGCCCGTGA
TGTATTTTTGTTCGCCTGCCCAGGTGATGAAATTGGTAGACATGAGGGAC
TTAAAATCCCTTGCCTATTGTTGGCGTACGGGTTCGATTCCCGTCCTGGG
CACATTAAAAGGCTTCCGCAAGGGGGCCTTTTTTTTAGTGCCTTCTGATA
GCTTGTTAGTGCTGAGCCAGTAAGGGTTTTCTCGTATGATGCTTGGCAGT
AAATTCCTGAAAATCTATTAGGTTAGATGCCTTTGTTTGTGATGTCTGGT
TAATTGATTGAGACGTCAAGTTAGGGTATCTGCGACTCACTTGCGACTCA
CTTGCGACTCATTCTGCGACTCACTTTAGAATCAGGGAAGACTGATGCCT
GTTATATGCCAGTTAAAAAGCCAAAAAAACCTCAAACCATTTTCTGTTTC
ACAGACCCCCCCTCTTGAAATAAGTCGGTTTTCTTTTGCGGGCAGCCTTC
CTAAAACGGTATATAACCCCCAACCTGTGGATATCTGATACCACAGAAAT
GTGTCCGTATGGTGTTATATGCTAGTAAATACCTAATAATCAGTATGTTA
ACTGTAGTTCATCCCCCCGTTTTGTTTTAGGTTTGGAAACCATCCTGCAG
GAGTTAACCCTAATATCTTAGCGTAAGCAGCGTGGATTGAGTGTGCCTAT
GGTTTATTTTTCAAAGCCCTGATTAAAAACCAAACTGGAAAGACGATACC
ACATAAGTAAGATGGTATAAGTGTAAGTTCTTTTAAAACCCCAACCAAAA
TGGTTTCCATTCCGTTTGCATATAAATAGTAGAATAAGCCAATATTGCCC
CAAGAGCCAAGGGTAACAATAATCAAATATCTGTTTTTCATAATCCTAAG
CTGTCTTTCAAAAGTAATGAATAGGAGGTAGCTGAGCTATAGGTGCGTTA
TAGTGTTGACTTTACTTCTTAAATGTTGATTTAGTGTTGACTTTATGTTG
ATTTTTTTTTCTAACTTCTTGATTATCATTCTAAATGTTGATTATGTTGA
TTTTTATACTCTATCATAGGTAAGAAAAATATAAATAATAAAGTTTTTTA
CTATTGCTATATAGAGGGGGTAAAGTTGACATTCGACATTTCCACAAAAA
TTGGAACATCTTGTGTTTCAATCTAATTATCTCAAGGTCAAGTATAATAA
AGTAACGCCTACCCTTCCTTTCTAGGCCCTTTTTAGCCGCTCTAAGGCCT
TCCGGCTATCTGGGTGGAACTGCATTTGTGGCTAGGGAAAACTCCTGAGG
TGGCTTAATAATTTAAGGCTCCCTAATAGTGCTGATTAGCTTGATAGACC
TGGCATATCCTCCTCCTTCAGCTCGGCTACCTCAAGACCCCTCAAGTAGG
TTAACGACACTTGACCTCATAAAAAAGCCTCTTCCGAAGAAGAGGCTCTG
TATATGATGGTTGCAAAAGGAATTTACTTTAAACGGTATCCAACTGTGAA
TGAGAAAGTTGGAAGCACAAATGTCTCTCCAAATATAGTTTGTCTGCCGG
CTCCAACCTCACTAGCTATTGACATCTCATCTAACATTACTTTTTTCCCA
ATCATCACATTAGTGTTGGCACCGTAACCGGATGCACCTAAACCGTTATC
AGTGTAAAATCTGGAACGATGTCTTGCTGTTATGTAGAGTCCCTCTAAGG
GTCTGAAAGGCGCTTGTTTTAGTAGTTCTCTTCTAAGGCGACTATTCTCT
GACGTAAAATACCTTCTTGCTCCAATCATAAAGGTACTAAGGGTAGATTG
GTCAAATGTACTTGTACCGGCACCACCGTCAAATAAAATAGAAACATCTT
TACCCGCTTGGACTTCAGCTCCAAGGTTAACAACGCCTTGAAGGAGTGAT
ACTGGTCTTGTATTGAGTTCAAAACCATTTTTTTTGATTTGTCCGTTCAT
AGTGAACACCAATGAACATAATAATAAAGTTGTGATTAGTTTCATAATTA
ATTAGTTTTATTTATATAAATGTAGGCAATATTTTATATTCAAAATAAAA
ATATCAAAACAATACTATATATTCGTTACTATCCGTTAAAATCTAATTTC
AAAGTCACAAAAAGTATCATATATGATATGTTGTTTTATGTATCTGCTGC
TACTACTCGGGCAAGTCCTCAACATCCAACTGAGACACTTCTAAGCCCCT
GAGGCAAGTCAAGGAGACTTGTAGAGAACTATGCCCCATCACCTGCTGAA
GTGTCGTTAGAGAGCCTAATTTCTTGAAGACATTGACGGCACAGAGCTTG
TTTCACTTCCTGTATATTTACCTCAGTATGAAAAAGCTTCTTTTTATTCC
AATAATGTCATTGGTTCTGATGATACTACCTTCTTGCGAACAAAACACTT
CGTCAGACATATTCTATTATGATGAAACAGGTTGTTCGGATGTTTGGTGG
CAGGATACACCATCCGGGGATACTTTAACGCCTCAAATCTATGAAGATTG
GGTCACGTCTTATTTAGAAAACAAAAACATAAAGGTCGTATCCTTTCAGG
TTATATATCCTTCGACAGTAGTTTTATCCTGCCGAGCTTGCCATTGCAAA
ACAGGGGATATACTTCAAGTTGAAGTTGAAGTTAAGTCTGGGAATAAGCG
TAAGATGAGAAGAATAGGGTTTTATCAGTAAACATCGATTGTTCTTGTGT
TTAAGACCCCGGCATATCCTCCTCCTTCAACTCGGCTATTTCTAAACCTC
TTATACCTACATTTCTTAGATTTGGATTATGAAAGAATCTAAAATATCGT
TAGGTGCAGGAATAGGCTTAATTGCTGGAACTATTATTGGTAATGCCACA
AATGATGTTGGCTTGTGGATTGCATTAGGTTTATGTTTTGGTGCAGGAAT
TGGTAGTGTTTTAGAAAATAACAATAAAACCAAACCATAGGCATATCCTC
CGCCTTCAACTCAGCTACCTCAAGACCTATTAAGTAGGTTAGAGATACTT
TCATATTGTTATGACCCATCATTGCTGAAAGCAAAAAGCGAGATTCATAG
TTATTAAGTGAGATTATTGTTTTCGTGTTCAAGCAACCATAATTTGAATT
TGTCTTCCATAGGTTCTGATTCAAACTCAACAGGTTCCTTTGAAATATGA
CTCATTGAATACCCTTCCAAGGGGTCATCTCTCTCACTGTCATCATCATT
GTAATCATCTGCTAACTGATAAATTTCACCTTCATCGCTTTCAAAAATCC
AAGTTGATTTATCTTTTTTTCTTTGTTCTATAAGATTCTTAAGAATTGAT
TCGCACTTTTCTTCATCGTAATCCGATGATATCTCATTGTCACAAGCCCA
AAAAAACTCGTTCTCATCAGATATGGCAAGAGTTCCATCAAAATGACCAT
CCCACCAAATCATATCAACATCATCTAATAAATAACTTGGTATAAAACCA
ATAAAATCCTCTAATTGATTAATAATTGGCTTTAATTCCTCCTTTTTTAT
CTTGAAATCAATTTGCCTAATTGAGCAACATAAAGCAGCCCTACAGACTG
TCATTTCAGCCGTGAAAGCTCCTTCCGCAAGGGCATCTTTAATTATATTA
ATTCTCTTCATAACCATAAATGTATGAATATACCTTACCGCACCCACACC
TTGTTATCCCATCCTTACTTAGCTCCCTAATAGTGCTGATTAGATTGACA
GGCCTGGCATATCTTCTTCCTTCAACTCGGCTACCTCAAGACCCCTCAAG
TAGGTTAGAGATACGTTGATAGATGAATGCCCCATAGCTTTCTGTAGCTT
GGTTAATGACCCTGTCCTTTTGAAGATGTCTATAGCCCCTGAGTGTCTGA
AAGAGTAAAGTGTCTGTCCCTCTTCGAGGAGGTTGGAGTGACGTTTATAT
CTGCCCCAAAGGTCTCCAAATATCCCTCGACCATAAGGGCTTTTGAGGCC
TGTAAACACATTCGCTCCACCTGCATAATCAGAGTGCCTTAGGGCGGCTA
AAAAGGGCCTTATATAGGCAGGAATAGGCACTATTCTATTGCGTCTTCCC
TTGTTCTGATTGCCAGCCAATGAAATCATCGTCAAGTCCTCATTGAAGTC
ATTCCAAGTGAGCAACCTAATCTCTCTGTGGGGTCTTAAAAGACAGCCAT
AAGCCAAGAGACAGCACAGATGTAATCGTTTGTCAAACGACGCTATATCG
TTCAAAATGCTGCTGACATCCTTGAATGGTTTGTGAAGCGTCTCAGTCAC
CCTTTCTTTCTTGCATAATCTCTTAACAGAGCCTTCATAACCATATTGAT
GGAGTTTGTCCTCCAAGGACAAGAAGTGACCCCTGATATTGTTCCTCATA
GCAGGAGACCACTTGGGTTGATTGAGGAACTCAGCTGCCAGCTTGGGAGA
GATGCGTCTCTCCTTGTTGAATGCATTCATCTCCTTCACAATCCATCTGA
GTTTCTTTTGGTACTCAAGAGAATAGTCCTTCTTTAACTTGTCTTTCAAG
GCAAGGTTTAAGACTTCCCTGTTGCTGTAAGTTTTCTTGTTTAGTCGTTC
CTTCCAATTGTCCATTGGGGTCCATCCCACATTGATGACTCGTTGGAACT
CAATCGATAGGTTCTCAAACCCCTGCCTTCTTGTCTTCACAGGCAATGCG
TTGGGCCTTGCAGTAGATGCGATGGTTTGGCCATTGTAAAAGCGGTAACG
CTTACCATCCCACATCAGTGAAATGCAAAACCTTTCCTTTGAAACTTTGA
TTACGTTGATAGACTGAAAATGACCCATTGCGACTCCTTTTGCGACTCCT
TTCACAAGGGGCATTTACCTAAAGGGTTCAGTGTCAGAAGATACAAGTGC
CTTGAACGAGGGACTTAAAATCCCTTGCCTATTGTTGGCGTACGGGTTCG
ATTCCCGTCCTGGGCACATTAAAAGGCTTCCGCAAGGGGGCCTTTTTTTT
AGTGCCTTCTGATAGCTTGTAAGTGCTGAGCCAGCTTCAGATAGTTTAAG
TAAAAACTCAATTTTGTAAATTAGGGGTATGAAAAAATTAGTTTATATAT
TTTTAGGATTATGTTTAGTATTTGGATGCACTGACGATACCATTCCTCCT
ATTGATGTAGGAAATCCTAACGCAGTTTACACCCTTGAATTAGATTTCTC
TGATGAATTCCCTGTTGGTCATAATCTTGGTCTAAATTACTATAATGATA
TTACTGTTGGAGTCATAGACTATTCAGAAAATAGTGTTAAGCTATTGACA
GCATCGGGAACTAGTTCCTATGTTTTAGTAGGAAATTCTTTAGACAACTT
ATCTAGCAAGAATCAAGTTGCCGCTCCGATCCAAAACACTTATTACTCCA
ATTACGTTGGGCTAGGACAATTAATTAAAGATGATAATGGTACAATCTAT
AGTGTATTTCATTCCGAACAACACGATGGAACTCAGTGTCCGGGTAATGT
GCAAGGCTTTTATGCTTCTGTAGGTTTAGCAACTTCTTCTGATAATGGTC
AATCTTTTCAATTATCAGATTCGGTATTAATAGAAAATACGTATGCTACT
AACTATGATAATGGCCAATGTGATGGAGGGCTTGGCGAGCCATCTATAAC
TTTCTCAAAAGATTCTACGAAAGTTTTTGTTTACTATGGAGACCATAACA
GAGACGGTAGAGGTGTCAATATTTGTATGTCAATGTTCAATGTTAACGCT
AATCACGTTCCAGATTTTGACAACCCTTATTACTTAGACTCCGACAATAG
CTTTACTAATGAAGTTATTCGCTCAAAAGAGGTTGTAGTTGGTATGGGTA
ATTCTGACGCCATATTTCCTCACGTTACCTATAATAGCTTTAGCGACTCT
TACATAATGGTATACTCTGAAAATAATTATGGAGAATTTTTAAACGGAGC
TACAAACCCGTCTGCCTCCGGAGTCTATTATAAACAATCAGATGATGGTA
TAAATTGGGACTCTCCGGCAACTCAATTGATAACAGATTGGTCAATTCCT
TGGAGTTTTGACAGCCATTCTTTCAGTTGGCACCCAAATTTAATTTATAA
CAATGAAAATCAAACAGAAGGGTATTTGATATTCTCTAAAGCAAGTAGCT
TACAAGAGGGTCATAAAATGTGGGCAGTTAAATTTAATATTGTTGCAAAC
TAAACCACAGGCATGCCTTCCTGTTTTAGCTCGGCTACCTCTGATTCATT
ACTTTCGGGTGATAACTTGAGATTATGAAAACAATCACGATTACTTTTTT
AGCGCTTCTTATTGTAGCGTGCGATAGTCCTAAGAAACAAAACACAGAGA
AGGTTTCTACCTATTTAGACTATTCAGATAAGGCAGACAAATGGTCCGGT
GGCTCTCAGCTCATCCCGGTGAAGACACCCATAGGCGTCTTTAATGTTTG
GACGAAAAGAGTGGGAAACAATCCCACAACTAAAGTCTTGTTGCTGCACG
GAGGCCCGGGCGCTACCCACGAGTACTTTGAAGCGGCAGATTCTTATTTC
CCAAATGCTGAGGTGGAATACTACTACTATGATCAACTGGGGTCCGGGAA
TAGTGATAACCCAGATGATCCATCTCTATGGGAGACGGAGCGATTCGTTG
AAGAAGTTGAGCAGGTACGAATAGCGCTGGGCTTAGACTCAAGCAATTTT
ATTTTGTTGGGTCATTCTTGGGGAGGTATTCTAGCAACCGAATATGCGCT
TAAGTACCAAGAAAATCTGAAAGGATTGATTATCTCTAACATGGTGGCTT
CTATACCAGAGTACATGAAATATGCAGAGGAGGTATTAGGCCCACAAATG
CCGGCAGAGGTGCTTGCAGAGATTAAAACGTTAGAAATGGCTGGTGAATA
CACCTCAGACCGCTATCTCTCTTTGATAGAAGAGCATTACTATCCAGAGC
ATATACTTCGCCGTCCTTTAAGCGAATGGCCAGAACCCGTGAATCGCAGT
TTCGCTAAAATGAACTATCCTCTGTATTTGAAAATGCAGGGCCCAAGTGA
GTTTGGCGTAGTGGGCGACGCGACACTGAAGGATTGGGACAGAACAGGAG
ATTTACACCTGATAACGGTTCCGACACTAAGCATAGGCGCTCAATACGAC
ACAATGGATCCAGAAGGCATGAGAAGAATTGCCAATTCTGTTCAAAACGG
TACATTTTTATATTGCTCAGAAGGAGGGCATATGACGATGTATGATGATG
CGGATCGTTATTTCAATGGAATTATTGATTTCTTGGATAATTTGTATTGA
ATATTGTAGGGTTTCCTAATAGTGCTGATTAGCTAGATACTTGGCATATC
CTATTGTTTTAGATTAGCGACACTTGTCGTTCTTAATAGATCTTTATGCT
GTATGCTTTAACCTCTCGGTCTAGCTTCTTAGCATCTCCAGAAACCATGT
CCAAGAGCTGCCAGAAATTGCTGCTGTGGTTTTTAATCTTTGTGTGAACC
AATTCGTGAAGAATGACATAGTCCACAAGGTGGTCGGGCAATCGCATGAG
GTGGAGACTTAGATTGATGTTGTTGTTAAACGAACAACTGCCCCATCGTG
TTTTTGCATTCTTAATGGCTACATTTTTATAAGTAAAATTGTGCTTTGCT
GCCAAGGCTTCCACCCTAAAAGGAAGATGATCTTTGGCTTCTCTGCGCCA
GGCATTTTCAATAGCTTTTCGAATTGCATGCTGAACCTCAGCATCCGCTA
TTTGATTGGCGTGAGGTATGGTGACGGCTATTTTGTTATCCCTAACAACA
CACCTCAGTGTGTCTGTGCTTGAAACCTTAATCTCTAAGTGATGTGCCCG
CGTTTGGAACTCCGTGTCAAGATTGAAAACGGTAAATAAGCCTTCCGCTT
TTTCCATCTTAGATAGATGAGACTTGATCCAACTGATGCGTTGTTCCGTT
GCTTCTTTTGCTTTTTTAAAGCTCACAGAATGGGGGACAGATACACGAAC
ACCCGTAAAAGGTTTAATGGTAATATTTAAACGCTTTGCACGCTGGCTGC
GAAATAAGGCCACATCAACGCCTTGTATATTTATAACCTGTTCCTCTATT
TCCATCTCTAACTGCTTAGCTGGTTGACCAAATATAATACAGGCGTACCC
TCATCCTTAGATTGGATGCAGGAGAGATCTATCATCGAATAGCAATGATG
TTGCCGGTCAGAAAAGCCACAGAATTTTTGAAGTGAACGCAACACCTATT
TCTAGGGTAAGCGAAGCTGTACCTTCGTGGCATGCGTCGATTGAGTCTTT
GTTTCACCTTTTGCCTGCTTGGATCAATGGTGCAGGGTCAAGACTTCAGC
AACAAGCCTTTAGCCGTCGCCTACATGCAGGATGTGAGAGGCATTGACAG
TGCTCAATCATGGAGCTTGTCAGTCCTGCCATTCTTGCGCAATACAGAAT
TTTTTCATTACCAGCAGCGGGGCCGAACTACCATGGGAGCCATGAGCCGT
TTGCTGTGGCAACAGGGGGATGCTCTGCGCATGGAAGTTGGCCTTTTGGT
GCATCATGTGTTTGGTGGAGACAGTCATGTCCTTCCACACTTAGCAGCGG
TACAGCAGATTGGCGAGAAAGGTGATTGGTCATGGCGATTTGGGACATTG
AACAACCCGGGTCATGGGTTGGTTGAGCCCTTGTACAACCCGGATTTGTG
GTTGAGGCGACCCGCAGAATATGGGCTGCAACTGCAAGGAAACAACATGG
ACCTTTGGTGGTCATGGGACAGGGCGATTGAAAAAGAGAGCCCATTCAAG
GAGGCTTTCACGATGGGAATGGTGACTAACCCTAGCTTTGAGGTGATTCC
AAATGTGGCTGTTGGCCCTAGCGTGCAAATTCAGTTTCATCATGTGGGTG
GGCAAATTGACAATGCGCCTCCCCAGCCCACAGGCAATCGATTCGATGGT
GCCATCGGTTTGCATCTCATGCATGAAGGCAGTGTGCATAGTCGGATTGA
ATGGCTTCAACTCTTCTATGCTGACCCAGATCAGCGATTTTCTCAAGTGA
GTCAAGGCAAAGGCCAGTGGCTCTCGCTCTCGCAAAAGAAGCCATTGAAT
GCAGGAAGTCATCTGCGTTGGGGGTTGGCCCACTGGCAGGGGCAAAAATT
CTTGTCAGTTAATGGACAAGGTATCTACCAATACATGGACCTCATTTCAC
TTCCTGTGATGCCTGAAAACCAATGGCTCAAATGCAGTTTCCGATGGGAG
AAAGCCTTGACTGATGATGCCATGCATGGTCAGTTATCTTTTGGGGTGGA
TCAGTACCTGGACCTCTTCAGCAAGCAATGGTCCCCCGTGATGAGCCTGG
CCTATGGGCTGAGCTTGTGAACGGGTGGTTGCTTAAACCCCAGGCAATGT
GATTTGATAATGCAGGCCAAGCCCTATGAGGGCATGGTTCAAATACAGGC
GTGTGCGCCAGTGATCACCCAAGGTATAGGTGAGGGTGTAGTTGGGGCCA
AAAATCACATCGCCTCCCATGATGGGCTTAATCGAAGCACCTTCAAGCTC
ATTGAGCATGCCATAGCCAGTGAGGAATCCAAGTTGTATGGCGGATGCAA
GTCGGTCATTGTGCTTGTAGGACCACTCACCACCGAGCATGAATGAGAGC
TCTCCCCATGAATTGATCATCATGGCTTCATGCAAGACCCATTTTGCCTT
ATCTCCTTGCCAAAGGGGCACCTGCACGTTGAAAAGGGGATGACTTTGAT
TGAAATGGTAAAGCCAGGTGGTGTCTCTGAATCTGTGCGAATGTTCGGAA
TCACCAGGGAACTGTGTGCCGGATTGCCAGCTGCTGGGAACCTCAATCCA
ATCATGCAATTCAGCAGGTGGTTGCATATGGAAGGTGTGGAAATAGCCGA
ATTCCATGGTGACTTGCGCATGAAGGGCAGGAAGTGACGTATATGCCAAT
ATGATGGTAAGGAGGGTGCGTTTCATGCTGCGAAGATAAACCGATGTAAA
TTTGGCAGAAGGCACTGTAACTGTATATCGTACACTAAGTATATTTGAGC
CATGTTAAAACACCTTGTATTGTCTGTTGTCTTGCTTGGAAGCCTCGTGA
TTCAAGGCCAAATTCTGACGATTGATCCGGCATTCCCTACACAGAACGAT
ACGGTCACCATTGTCTACAATGCCAACGAAGGCAATGGCGCCCTCCAGTC
AGTCAGTCCGGTCTATGCGCATGCAGGACTCATCACCAGCAACAGTTCAA
GCCCGACAGATTGGAAATTTGTGCAAGGCAATTGGGGTACCGCAGACCCC
AATGTTTTGATGACATCAATGGGCAATGACTTGCACGCCATCAGCTACCA
CTTGCCCACCTTTCACAGCTTCAATGCCAGCGTTCAGACGGTGTTAAACT
TAGCCTTTGTCTTTCGCGATGCAGCAGGGAACACTGTCGGTCGAAGCGCA
GACGGTTCAGACATCTATTACCCGATTTATCCGGTGAATGCAGGCTTGTT
GACGGCTTTTTTCAAGCCCTATGACTTTCAGATTGTCGCATTGAATGACA
CGCTGTCTGTTCGGGTGGCTTCGAATGCATCATCCATCCTTTCAGTCTAT
GACAATGGCGTATTGGTGGCCAGTGACAGCGCCACCAAGTTGATGCAGTT
TGACTTGCCTGTGAGCTCAGTGGGACAGCACATGCTCGTGCTGGAGGCTG
AAGATGGGTCATCCGTTGCGCGTGACACAGCGTACTATTTGACCAATGCA
CCGGTATCGGTACAAAACCCGCCTGCTGGACTGAAGGATGGTGCGAATGA
GATTAATGATAGCACGGTGATTCTGCAGCTGCATGCGCCGGGCAAGCAAT
TTATTTACGTTCTAGGCGACTTCAACAATTTCATGCCTGATAGCAATTAT
TACATGAAGCGATCAGTCAATGGTGACAAATTCTGGCTAAGCCTTGATTT
GCAAGCTGATACCCGTTATGCTTACCAGTATTGGATTGATGGGGCATTGA
AATTGGCCGACCCGTATTCAGAGCTGATACAAGACCCCAATAATGACGGT
GGCATCTCAGCAGCTAGCTACCCTAACCCGCATCCCTACCACAGCAATGC
AGCGGGATTCACCTCGTTAATCCATCCAGGTAAAACTGATTATGTGTGGA
AAAACACCAGCTTTCAGGCCCCATTGAAAAAGGATTTGGTCATTTATGAA
ATGCTGATTCGAGACTTTGTGCATGCCCGCAACTACACCACGGTGATGGA
CACCTTAGACTACTTGCAGCGGTTGGGGATCAATGCCATTGAGTTGATGC
CAAACAGCGAATTTGAAAACAATGAGTCATGGGGCTACAATCCGTCCTTT
CACATGGCACTGGATAAATACTATGGAACGCCTGACATGTACAGGGAGTT
CATCGATTCATGCCACAGCAGAGGCATCGCGGTCATCATGGATTTTGTAT
TCAATCATGCCTTTGGCCAAAGCCCTTTGGTTCAGATGTATTGGGATGCG
GCACAAAATCAACCTGCAGTTGACAACCCTTGGTTCAATGCCACCTGTCC
CCATCCGCCTTATTGCTGGGGCAGTGACTTTGACCACCTGTCTCAGGCCA
CCAAGGATTTTGTTGATCGGGTCAACCTCCACTGGTTTGATGCCTTCAAA
ATTGATGGCGTGCGCTATGATTTCACCAAGGGATTTGGCAATGCTTCAGG
GGGATGGGATGTCACAAGGCAAAACTTGATCAAGCGCATGGCAGATACCG
TGTGGGCTAATCACCCCAATGCCTACATCATTCTGGAACACTGGGCTGAC
AATGCAGAGGAGAAGTTGCTGTCCAACTACGGTCTCATGCTATGGGGCAA
TGCCACCTACAACTACCGAGACGCAGCCATGGGCTGGGTCAATGGATCAA
ATTTCAGTTATGGGGTGTACCAAAACCGCGGCTGGACGCAGCCCCATTTG
ATCACCTACATGGAGTCCCATGATGAGGAGCGATTGATGTACGATGTGCT
CACCTATGGCAACAATGGAAGCAGCAGCCACAATATCCGAAACCTGAATG
TAGGCCTTCGTCGGGCAGAGCTCACATCGGCCTTTACCTACTTGGTTCCT
GGACCAAAAATGCTGTACATGTTCAGTGAGCTAGGCTACGATAAGTCCAT
CAACAACCCTTGCCGGGTGTGTAACAAGTCCATTTTGTGGGGCTACCAAA
ACGTCTTGGAGCGCAAGCGACTCTACGACGTGACTGCAGCCTTGATCAAC
CTCAGGCGAAGCCATCCGGTTTTCACCACCACCAATTTCACCTACAGTTT
TGGGGGTTCAACCAAGCGCATTAATCTGTTGCACCCCAATATGAAGGCGA
TCGTGATTGGCAACTTTGACACCAGCATCAAAAGCATGGTTCCCAACTTC
GCTCACACTGGGGATTGGTACGATTACTTCAGTGGTGACACCCTGAGCGT
GAGTGACCCTTACATGACATTGGCTCTAGCGCCAGGTGAATACCGGGTGT
ACACCGACAACAAATTGCAGCAGCCCACCATCACTTTAGGCACCCAGGAG
TGGAGCTTGCCATCCATTGCAGTCCAACTGAAACCTGTGCCTAGCGAACG
CTTTGTGGATGTTTCATGGGCCATGCCAAACCCTGTGGTGGTTCACCTGC
AAGTCAGGGACCTGCAAGGCCGCTTATTGCTGGACAAAGCCTGGGATGCT
GCACAGAGTCCAGATGCTTACCAGGTTGACATGCAGGCATTGCCGTTAGG
CATGCATGTATTGACCTTGGATGTAGGAGGTCAACGCTCTCAGCATAAGC
TCATCAAGCAATAAGCCATCTGGCTTAACTTGCTGAGATGTCTCAATCAC
GTATTTCCTGGAAATCTTTAGCCCTTGCTGCGACATTGGTGACGGGCTCG
CTGCATGCACAAGCCACCTACCATTTGTCCCGATCTATTGATGGACCCAT
CATCGCTGGCTCAATGATTGGCTTAAGTCTGGACTGGCAATGGCGATCAC
AGATGCAAGGCTTCAGCGCATCAGCTTTGCAAGATTTGGATCCCAGCCAG
GTGCCTGTTTTTGATCGCTACGCCCTGGGTCGTTGGAGTCCGTCAGCTGG
AGAGGCATCAGATGTTGCTTTGCTTGGTGCTTTAGGCTTGGGAGCCAGTT
CAAGCCTTCATGCAGACAACCTTCATCAGTTTCTTGTCATTGGTGTGATG
TGGGCAGAAGCCAACATGGTTACAGGCACCGTGACCGACATGACCAAGCA
CTTGGTTCATCGCGCCAGGCCATACGCATACGGCCCCCTTGTGCCATTGG
A