Fosmid24C4 43501 bp


ATCTTTTGGAACAGATACGCCTCTTCGTTGGTACATTTCGCAGAGCCAAA
GCCAGCGACTTTTGTGCCACCGAGGTCTTTCATCCCGTTCGCTGCGAAAT
CGAGCGCTTCGTCCCATGATGCTTCGCGGAAGAATTCGCCCCAGTTAGCC
GGATCGACGTTCAAACCCTTTGCAGGCGCATCATCGCGGCGGATCAGTGG
CTTTGTCAGGCGGTGGTCGTGGTGAATGTAGTCGAATCCAAAGCGGCCTT
TGACGCACAAACGCCCTTCATTTGCCGGACCATTAATACCTTCGACGAAT
TTGACCTTGTCGTCTTTGACCTTGAGGGACACCTGACAGCCAACGCCGCA
GAATGGGCAGACGCTTTTCACTTCACGATCAAAGTCAGCTGTGTCGCCCA
CTTGGTTTTTGTCCGTGACTGTAGCGGGCAATAAGGCGCCCGTTGGACAG
GCCTGCACACATTCACCGCATGCCACACAGGACGATGCGCCCATCGGGTC
ATCCATGTCGAAAACCGGATAAGCGTTGGTGCCGCGACCAGCCATACCAA
TGACGTCGTTCACTTGGACTTCGCGGCAAGCACGGACGCAGAGCCCGCAC
TGGATGCAGGCATCAAGGTTCACAGACATCGCAACGTGACTGTCATCAAG
CAGTGGGATGTGTTCTTTTTTCTGCGCTGGAAAACGGCTCGACGAAACGT
CTTGCTGCGCGGCCATATCCCAAAGGTGCGAAGATTTATCGTGCGCAACC
TCTTGCTTTGGCTGATCAGTGACAAGCATTTCCATCACCATGCGACGCGC
CTGAACTTCGCGCGGCTGGTCAGTTGTTACGACCATGCCGTTGGATGGTT
CACGGATACACGATGCGGCCAAAGTGCGTTCACCATCAATCGCGACCATA
CACGCCCGGCAGTTTCCGTCGGACCGATAGCCCTTCTGCGGCTTGTGGCA
GAGGTGAGGAATGACAAGGCCACGGCCATTGGCAACTTCCCAAATCGTTT
CACCGGGCATTGCGGTGACTGCCTTACCGTCGAGGGTAAATGTGATCGCG
GACATGGGCGTGCTCCTTGTTGTCAGAGCAACCTACACCATTTCCACGCA
CATTAAGACAGGCCATCCGCGACCCCGATCCGCACATTTACGCCATGTGC
TGTTTCCGAAGCGAAATCTGTGGGCCTGAATCGACAAAATCAATGGCCCA
CAAGTTTTAGGTCACCAAGATTTTTCGAACAAAAAAGCCTTGGTATTTGC
CTAGAAAAACGCTGAAGAGTTATTGATCAGAACAATGCGCAGCACTTCAA
GCGCAAGAAGGGCCGCGATTGGCGAGAGATCAATTCCGCCAAGGTTCGGC
ATGACACGACGGATCGGCGCATAAAGCGGCTCTAGTATCCGTTGCAGCAT
GTTCCAAATCTGGCCGACGACGGGCTGTCGCACATTCAGAACATCAAAAC
TGATCAACCAGCTCATGATGAAATGCGCAAAGATAAAGAACCGGGCGACG
CCGATAAGCATCAAGAGAATTTCGAAAATGGACTGCATGGTATGACCCTT
GTTATGTGCCCTGCTGAGTTAAGTTCTAAGAACCGCCACCGCAAGCCCCC
CACTTGCCGTAGCGTTTAAGTTGACGTGCACGTTAACTAAGCAGAGTGGG
TGCTTATTAGATTAAGGACTACTCAATGTTTCCTTTCGTTCGCCTTGCCA
AAGATATGTTTCTGTCCCGCAATATGTCCGATCTTCCTGTTCTTGGAATT
CATGTGTCTCATCACCGGTGCTGGCCCCAAGATATTGATCTTTTTATGGA
AATGAACAACGGTCGCATTTTATCTATCCTTGATTTAGGGCGAACGGTGC
TGGGCAAACGTGCTGGTCTTTTGACTGCACTCAAGCAAAGGCGTTGGGGC
ATGACAATGGCAGGCGTCAGTGTCCGCTACCGCAAACGCATCCGACCCTT
TGTGAAATTCAAAGTCGTTAGCCGCGCCGTTGGATGGGATGATAAGTTTT
TCTATCTTGAGCAGTCGATTTGGATTGGTGAGGATTGCGCCTGCCAAGCC
CTTTATCGGTCAGCGATCACGGACAAGAATGGCATCGTTCGTCCCCGTCA
GCTGTTTGATCACATCGGTTTCGAAGGCGAGCGGCCTGTTTTACCAGATT
GGGCGCAGAACTGGATCGACGCCGACCAAACTCGCCCTTGGCCACCTGAA
ATTACACCACATTCAGCCTAACCCAATACCACTCTTGCCTTTTCTCACCC
CATCGTTGTCTTATCCCTTCAATCGAGGGGACGATCATGACAATTTCGGC
AAAAAAACGCATTTGGGGATGGATGAGCTTTGATTGGGCCGCGCAGCCTT
ATTACACGCTTGGCCTAACATTTATTTTTGGACCTTACTTTGCCGTTGTA
GCTGCAAGTTACTTCATGGGCCAAGGCTTAGACACCGAGGCCGCAGGCGC
ACAGGCCCAAAGCACTTGGGCACTTGGACAAACATGCGCGGGCCTTGTCA
TTGCATTCACAGCGCCATTCCTTGGCGCTTTCGCTGATAATACTGGACGT
AAAATGCCGTGGATTATCGGCTTTTCAGCGCTCTATGTTGTCGGTGCATG
GTCACTTTGGTGGCTTACCCCGGATAGCAGCAGCTTGATGCTGTTTCTAA
TCCTATTTTATGTTGGTTTCATTGCCGCCGAATCCGCTTTGAACTTTGTG
AACGCCTACCTGCCATCGCTTGGCAACGCAGAAGAGGTTGGGCGCATCTC
AGGGTCAGGCGCATCTTTTGGCTATTGGGGCGGTCTTATCGCTTTGATTA
TCATGCTTTTGCTTTTCGCAGAGGACGCCACGACCGGCAAAACACTGATT
GGCTTGGACCCTCTCTTTGGGCTGGACGCATCTGCGCGCGAAGGCACGCG
CGCCGTGGGTCCATTCATGGCTGTCTGGTTCCTAATATTCATGATCCCAT
TCTTTTTGTGGGTGCGCGACGACCCTACAGACGCTGGCGATACCCCGAAG
ATGTCCAAGGTTTGGAGCGATCTGAAGCAAACACTCCGCAATGTTGCCAA
ACGCAAAAGCACCGCATCGTTCCTCATCGGGTCAATGTTCTACCGCGACG
CCTTGAACGCACTCTACGCTTTTGGTGGAGTTTACGCCGTTTTGGTGCTG
GGATGGAGCACGCTGTGGCTTGGTTATTTCGGAATTATTAGCGTTATTAC
CGCCGCCATATTTACCTATGTTGGCGGCAGGTTTGACACCAAAGTGGGTC
CAAAGCCTGTCATCATCTTTTGCATCATCTTGCTCACCTTCGTCAGCACA
ATCATTGTTGGTATGTCCCGGACCCACGTATTCGGTATCCAACTGGCTGC
GGATTCGAAGGTTCCAGACATCATTTTCTTTGTCTGCGGTTCGGTGATTG
GTGGCGCTGGTGGAGCGATTTACGCAGCCTCTCGGTCAATGATGGTCCGG
CACACGAACCCGGAGCGCCCAACAGAAGCCTTTGGTCTCTTTGCTCTTTC
GGGCAAAGCCACCGCCTTTATCGCACCTTTAATGATCGGTATATTCACAA
CCATTACAGGCAATGTGCAACTTGGGTTCTTACCCGTCATCTTCCTCTTT
CTTCTTGGTCTTGTGATGCTATTATGGGTCAACAAAGACGGAGATCGCGC
AGCATGGTCCGCTTCCTAGGCATCGCAACACTTTTGACCGTATTGGCCGC
TTGCCAATCGGAAGATACCCCATCAGTTAGCCAAGCCGCGATTTCGACCC
AAAACGTGGGTGATAATCGGGTGGCAAAAGACTTGTTTGGATATGTCCGT
GCTGGGTCCAATCAAATGCCGGAAGCCTTTGGTGGGTATGCCAAAGGCTG
CCAAGCGGGTGCAGTTCAGCTTCCCGAAAGTGGTCCAACATGGCAAGCTA
TGCGCCTAAGCCGGAACCGGAATTGGGGGCAGCCTGAACTTGTCGATTAT
GTGCAAGACCTCAGCCGTTTTGCGGCTACCCTACCGGGTTGGGCAGGCCT
GTACCTTGGCGATATGAGCCAACCGCGCGGTGGCCCTATGCTTACCGGTC
ACGCGAGCCATCAAAGTGGTCTGGATGCAGATATTTGGATGTTACCACCT
GATCGCTTGAACTTAGATCGCCAAGAACGCGAGAACCTATCGTCTATCTC
AATGCGCCGATCACGCGGCGCCTATACCAACGGTCGCTGGACACCGCAGC
ATGAAGCTGTTTTGCGCGCTGCCGCATCTGATCCCCGCGTTGCCCGGATT
TTTGTGTTTCCGGGTGCAAAGGTCGCGATGTGTAATTCAGCCACTGGTGA
TCGTAGCTGGCTTAATAAAATCCGGCCATGGTACGGGCACCACTACCATT
TCCACGTGCGCCTCAAATGCCCAGCGGGCGACAATGCCTGCAAAGATCAA
GCGCCACCGCCAGCTGGCGACGGGTGCGCAGATGCTGCACGTTGGGTAAG
CGATATATTGAATCCACCACCTCCACAGCCCCGCGATCCAAATGCGACGC
CAACACCACGGCGTGGTCCAATCACAATGGCAAGCCTTCCGGGCCAATGC
CTAGGCGTTTTGAACGCGGAATAAATGATCAAAATAGTATTTTCAGCTGC
CATCCTTTTAATGGGCAGTCTTAGTTTTGCTGAGACCGCCCTTCTAGGTC
GTTTCGTCATACACACAGATAGTGGTCACATCGGCGGGCTGTCCGCTGTG
CATCTTAGTGCTGATGGAACGTCACTTATCGCAGTCAGTGATCGTGGCAC
GCTTTTGTCGGGGACAATTTCGCGTGGAAGTGACGGTGAGATTGTTGGGA
TCGTTATGGGAGAACAGGCCTCATTTCAAAACCCTGACTTACCAAACAGT
CGTACAAGCCGCGATTCAGAAGGTGTGGCAGTAGATTCTGACGGCACAAT
TTTCGTGTCCTTTGAGGGTGAGCACCGGATTGGGAAATTTGCGTCGATCA
ATGCACCCGAAGAAATGCTTCCTATTCCAAGGGAGTTCACGGCGCTACAA
AGCAACAGTGGCCTAGAGGCTTTGGCGATTGATAGCGATGGTGCCCTGTA
CACGATTCCGGAACGGTCAGGGCGGTACGACCGACCATTCCCAGTTTATC
GGTTCAAGAATGGTGTCTGGGATCAGCCTTATGACATCCCACGCACTGGG
GCCTATTTGATGGTTGGGGCAGACTTTGGCCCTGATGGCAAACTGTATGT
GCTTGAAAGGGACTTCACCGGGTTCGGGTTTTACACACGCGTCCGGCGTC
TTGATCTGGGGGCTGCGAGCGCAGAAGTTATTTTGGAAACAGGAATTGGC
GTGCACGGGAATATGGAAGGTGTTTCCGTATGGCGCAACGCTGACGGTCA
GATGATCATGACACTTATTGCTGACAACAATTTCCGTAGCCTGCTGAAGA
ATGAGATCGCAGAGTATCGCATCGACGGTTGACCTGTCCGCTGACTGGAC
CTAGTTGGGCGCGTCCCTGAACGGTTTGGGGGCCAAGTGCCGCACCCTTG
CCAAAACGGAAACCAATAAAATGAAACGTATCTTACCCGGCGTTATCGCC
ATGGCCGCCATTGTGGTCGCCTCAAATATTCTCGTACAATTTCTTATCCT
TGACGGCCTACTGACTTGGGGCGCATTCACCTATCCACTGGCGTTCTTAG
TCACAGACGTGATGAACCGCTTGTATGGAGCTGCGACAGCAAGGAAGGTT
GTGTTTGCGGGGCTTATAACTGGAATTATATGTTCCTTGATCGGAACGCA
GATCATCTTTGACAGCGAATATGGACCATATGCAGCTGTCGCTTTGCGTG
TCGCCATTGGGTCTGCGATTGCATTTGGGGTCGCCCAATTGTTGGACGTT
GCAGTATTCAACAAGCTGCGTGACGGATCATGGTGGAAGGCCCCTCTGGG
ATCCACACTGGTAAGCTCGACAGTGGACACGGCGATCTTCTTCACTATCG
CTTTCTCGGCGCTTTTCAATGGATTATCCCAGGCGGCGGCAAACGAAGTC
GTCTGGGCACAAGACGCTGCCCCGTTTCTAACAACAGGGCCAGACGCACC
GTTATGGGTGTCATTGGCTGTAGCGGATTGGGGTGTGAAGCTTGCGATTG
CTCTCTTTGCGCTTGTGCCATTCCGTATAATCATTAACCGAATGGCGCCC
ACGTCAGCATAAACTTGGACCATACAAAAAAATATCTTGATTTTGACGGT
AACTATGCCACCCTCTTTTTATAGGCGAAACATTTTGAAAGGAGGTGATC
CAGTGCATCATGAAGTATTGGAGAAGGCAGTCGGGACAACTTGTGGGGTT
TTTCGCTAGGGCAGCCCTTAGCTGAAGAAATCATAAGGTGGGAAACCTAA
CCGACCCACCTCTGCTATTCAGAGAAGGGCCACCCCATCGCCGGGGCGGC
CCTTTTTCTATGTTCAAGGCCAAGCCGCATGGGGCAATGCCTAAATAGTG
GGCATCAGGCGGTAGCTTTTGATGATCAGGGACGGCCAAAAGACGCGTGT
GATTTGCGTGCGCAGCACGTACACAGGGCTTGCACCGCTTTGTCAGCGTT
CCATAGATTGAGTTGTTAAGGCGAAATGAAGATCAACGAGCAAATCACCC
TTGAGGATTGGGAGTTGACTGAGCAGTTCACGCGGGCGTCAGGGCCGGGC
GGGCAGAACGTGAACAAGGTATCCACGGCTGTTGAACTGCGGTTTGAAGC
CGGACGGTCGCCCAACTTGACTGAGGCCGTGAAGTGGCGATTGCGCCGCG
TGGCTGGGCAGAAATGGACAAACGAGGGCGCGGTGGTGCTGTTTGTGCAG
GACACACGGTCACAAGCCCGCAACCGCGAGATCGCGCAGAAGCGGTTGAA
GGATATGATCTTGAAGGCCTGCGAGGTCCCAAAGCGCCGGATTGGGACGA
AACCAACGTTTGGGTCGGTCAAGCGGCGGCTGGCAGGGAAGAAGGTGCGC
GGGGTTGTGAAGAAGTTACGGGGGAAGATTGAGGATGAGTGAATCTCCCA
TTGCGAGCTTTCGCATAAGTTGTTATTTGGGGCGTAGGTTATTTACTTGG
CGGACTTATTTTAATGACGAAGAGCCTAACCAACAAGACACGCAACGCAA
CGCAGCTGAAACTGTTCTGGCCTGGGCCAAAGACAACAACCTTTTTCGCC
GTGAAACTACCGACCAGGCAATCGATATTGAAGAAGGTCCTGAAAGTGTT
TCGAACAAGGTATTTTCCGCCGATGAAACTCTTGAGATCTTCAAGAAAAA
GTGCATCAATCTTGTTTTTTTCGATGAGGCCAATGAAGTTGTAACTATTC
TGACGGCTAAAAAGCTTACAAGGGCCGAAGAACAAAGCCTTCCATTTAGG
TTTAAAAATGAGGTTACTATAAACTATTCGCATGGTGGTGTTCCCCAAGT
CAAATCACCGTCAACGCAACCTCACGTTCAGCCTGTCACAGAAAAAGGTG
GTATAATTGCCTGCGGATCTTCAATTAATCCAGTGGATATTGTTGGCGCA
GGAACGTTGGGGGCAATAGTCAAAGATAAATCCGGAGCATTTTACGGCCT
TACGAACAATCATGTAAGTGGCGGATGCAATTACTCGGCGCCCGAAATAC
CGATACTATGCCCCGGGCCATTGGATGCAAAAAATTGTGCAATCGATCCC
TTTACAATTGGTCGCCATAAAAACCTACTTCAGTTTGTGGACGGACTTCC
GGAAAACGTTGATATTTCAAAAAACTCAGACGCTGCAATTTTTGCGTTGT
CCAAACCGGATCGAGTGTCATCATATCAAGGGCTTTCACAAGATACGCCT
AAGCACATCGGTGTGCCCATGGGTATGATGAAAGTTACGAAACACGGACG
CACTACGGGTTTGACGCGCGGAAAAATCATTGGTATTTCGGCATCACCTA
TTGATGTCGCATATTCCTATGGAAATATGAAAAAAGTTGTGTATTTTGAC
GATGTTTGGCTCATCAAGAAAGAGAATGACAAACCGTTTTCCGAACCGGG
AGACTCGGGTTCCTTAGTGATTGGCACCGACTCAACTGGGCAAAAAATTG
CTCTCGGACTAGTTTTTGCAGGAAATCCTCATTTTGGGCACACTTATATG
CTACCATTAAACCCTATCTTAACCAAACTAGGTGTAGAGCTCGTTCATGG
CCACAACCCTTTCATATGAATCTGGCATCAAGGCAGCACAGCGGCTTGCG
AAGGAAACTGGCTTCAAGTCGTTGCACGGCTCCATTACTGTCGAAAGCCG
TGACACTAAAATTGCGATTGTCGTAAGGCTGTTAAATCCGCGAAACCTTC
CCCCATTACCATTACCCAAACGTATTGATGGCTTTATGGTTTTAGTGGAC
GGCCCAGCTAGTGGGATTCCACATAAATCCACTCATCGGGAAACCCAACT
GCATTAAACCACAACTTCCTCAGCCACCTGCTCGCCTACTCCAAACACCC
GCTTGTACCGTGCGATCTCGCTTGCCGGGCCCATAGCTTTGTTGGGGTTG
TCGCTCAGTTTGACGGTGGGCAGGCCGTTGGCCGCCACCGCTTTGCAAAC
CAACGAGAACGGCGCAAGCGCGTCGTTGTCCGCCAACCCTTTGAAGTCAT
TGGTCAGCATCGTTCCCCACCCAAAGGACACCCGCACTTTGCCCGCGAAT
TGCGCCTGTAGCGTCGCGATTTTATCCACGTCGAGCCCGTCTGAGAAGAT
CACCAGCTTTTTGCGCGGGTCCTCCCCACGGGATGTCCACCAGTCAATCG
CGCGCTGTGCCCCCGTCGCCGGGTCTCCACTGTCGATGCGCATGCCCGTC
CAGCCTGCCAGCCAATCCGGCGCCCCTTTGAGGAAACCATCGGTCCCGTA
GGTATCGGGGAGGATGATCCGCAGATTGCCCTCGTGTTCGTCCTGCCAGT
CGGACAGCACGTCATAGGGCGATTTCAAAAGCGCCGCGTCGTTGTCCGCG
AGCGCTCCGTAAACCATGGGGAGTTCGTGGGCGTTGGTCCCGATCGCCTC
AATCTCGCGGTGCATCGCAATCCGACAGTTGGAGGTCCCAATGAAGCTGT
CCCCCAACCCTTCCTTGAGGGCCTGCACGCACCAGTCCTGCCAGAGGTAG
GAGTGCCGTCTGCGTGTCCCGAAATCCCCCAGTCGCAGCTCCGGCACATC
CCGCAGTTTATCAACCTTAGACCAGAGTTTGGTCATGGCTTGGGCATAGA
GGACTTGGAGTTCAAAGCGCCCCATGTCCTTGAGCACCGCCCGGCCCCGC
AGCTCCATGAGCGTGGAGAGCGCTGGGATTTCCCAGAGCATGACCTCGTG
CCATTTGCCCTCAAACGTCAGTTCATATTGCCCGTCCCGTTTTTCGAGGT
GGTAGGGCGGGAGTTTGTGGTTCTCGAACCATTCCATGAAGTCGGGCCGG
AACATCTGCCGTTTGCCATAGAAGGTATTCCCCCGCAGCCAAGTCGATTC
ACCCCGCGATAAGGACAAGGACCGGATATTATCGAGTTGCTCGCGCAGTT
CACCTTCGTCGACCTGATCTGCAAGCCGGATGTGTTTGGATCGGTTGATG
AGCGAGAACGTGACGTCTGTGTCCGGGTGGTTCCGGAAAATGGATTGGCA
CATCAGGAGTTTGTAGAAATCAGTGTCGATGAGCGACCGCACGATGGGGT
CGATCTTCCATTTGTGGTTCCAGACGCGGGTGGCGATATCGACCATGTTC
TTGTTCCCTTTAGCTTATAGGGGTTTAGAGCAATTGCTAGAGACTACTGC
AAGCTTGAAGCGCATCAAATCGGATGATCTTACGCTATTTGAAACATGAA
ATTAGTCGCGTTACCCTCCAGTCACTCGTGATCTGGATAACAATTAAACT
CTCCGTTTCTTGACCATCGCTTCATCATGCAGTCGCTTACTGACCTCTTG
TGATACGCCAAGGAACTCTTCGACTTGGTGAAGCAACGCGTCTTCTGCTT
CTGCCTCAACCCCGTCTGCGAACACGACCGCCCAAAGGGCTGCGACTGTT
GCTTCGCGTTCTGCCAAGCTAATCGCATCGTGCAAAATTGTGGAAAGCGC
TGCTGTGTCTGGCATTGCCGCTTCCAGTTTCTCGCATTCGGCCCGTAATT
TGGCTGCCTGCACTGGATTCAAATTATATCGGTGCGCCAACACATCGTCG
ATTTGTTCGATTTCTTCAAACAAATATGCTTTATCAATTTTGGCTGCCCG
CACCAGCAATGCCCCCATCGCATGTTGCACGTCCGCTTCGGGGAGTTTGG
TGACGTGAACTTCTGGTTGGAAAAGCGATAAAATGCGGTCGAACATGGAT
TAAGCTCTGAAAAAATTTAACCGAGCTTAGCGAGGCCATGCGATGGGGGC
TAGCCCCCAAACCCATAGGATATAGAAAGACCCAAAGTAACGCACGAACG
GTTGACCTCATCAATGCCGCAGAAGAGTATCACCGTGAAAAAGGAGAGTT
GCGATGACGGGTACGTTTCAGTTGCGCGTTGTCGCAATGGTTGTTGGCGC
GATGATTCTGATTGTCGGTGGAGATGTGGCTGGTCGCATGCTCACGGCAG
CTGGTTTCTCTCCGTTTTTCGTTGCTTGGGCCCGCTTTGCGTTAGCCGCA
GTTGTGTTGGCCCCAGTTTGTGGCTTGCAGCGCGGTGAAATGCGATTGCT
ACTACGGCCTGCGCTAATTTTACGGGCTTGTTTGATTGCCGGTGGCATCG
CCTGCATTTTAACAGCCCTTAAGACTGAGCAATTGGCGACTGTTTTTGGT
GGCTTTTTTGTTGGACCGATTGTGTCTTATATTCTGTCCGCCATCATACT
GCGCGAGCGCGTCACTATCCCGCGCACAGTGTTGTTGTTCATTAGCTTTG
GCGGCGTCCTTTTGGTCGTGAAACCGGGGTTTGGAATGACCCCAGGGCTT
GCCTTTGCCCTGCTTGCCGGTGTGTTTCATGGCAGCTATCTGGTCGCGAC
GCGGTGGTTAGCTGGCGGTTATCGCCCTCGTTTCTTGTTGTTTTCACAGT
TGATCATTGGCTCACTTGTTTTGTCACCGCTTGCGATATCTTCGCTTCCG
TCAGTCACACCATCTTTAGCCGGGCTCATTGTGATCAGTGCAATGGGATC
GGCAATCGGAAATCTGTTGCTGGTGTACGCAAACCGCATTGCGCAGGCCT
CAGTCATCGCACCACTGATTTATTGCCAAATTATCATCGCAACGGCATTT
GGGTTTCTGTTCTTCGGCGAATGGCCAGATGGCACAGCGTTGCTTGGCCT
TGGCGTGATTATTGCGGCTGGCGCAGGGTCAATCTGGGCGGCTGGCCGTT
CCCAGTGATGTTTATAGCGCCAATGTGAGTTTACCGAAGACTGGAATCGG
GCAATGCAAAGAGGCACGTCATATTTGGAGTATCGTCATGCGTTTACTGC
TCGCCGCCCTTCTCTCATTTTGGTCGATCACTGCCGCAGCTGAATCTGTG
ATGCCCGCGACGGTCAGGTCGTTATGGAAAGTGACAAGGCGTTTGGTATC
TTACTGGATGATCTTAAGGTCGCGGTCAGTGCCAACAAGATGGGCGTCGT
CACACAGGCGGGTCCAACCGGCGCTGCTGCCAGTCGCGGAATTACAACTC
CGAACAACCGCATTGTCGGTGTTTTCAACAATGCCTTTGCCGTTCGTGTT
CTTGCCCTGTCACCTTCTGCAATGATCGAGGCGCCGATCCGATTTTATCT
GACAGAGGATGAGGCAGGCGTTGCCACCCTGTCCTAATAAAACGCCTTCA
TTCGTGTTTTCACCTTATGTCGAAACAGCCGGCGATGATCTTAGCGCTGC
AAGTGCTGAGCTTGACACCATTTTTCTGGCGATTGCCGAAGCGGCCCACT
AAGATATAACGAACAGCCGAAGGATACCCCATGACAAAGACCTTGCGTGC
CGCTGATGTGCTTGCCCAACGTTTGTATGAGGCAGGCTGCCGTCACGCCT
TTGGCATGCCCGGCGGCGAGGTTCTGACATTGATTGATGCCTTGGAGGCT
GCGGGCATTCAGTTCCACCTCGCCCGGCATGAAAATGCAGCAGGTTTCAT
GGCCGAAGGTGTTCACCATATAGACGGCGCACCCGGAATTTTGGTCGCCA
CTGTTGGCCCCGGTGCGATGAACGGTGTAAACGTGGTCGCCAATGCGGAT
CAAGATCGTGTGCCGCTGATCGTATTGACTGGCTGTGTCGACGCGGCTGA
CGCGCAGACGTATACCCACCAAGTCCTAAATCATCGCAAAGTCTTTGAGC
CCATCACCAAGGCCACGTTTACGCTTGATGCAAAAGTCGCTGGTGTGATT
ACTGAAAAGGCTATCGGGATTGCCACCGAAGGCCGTGCGGGTCCGGTCCA
TATCGATGTGCCGATTTCGGTGGCTGATGCACCGGCTGTGCCCGCCACCT
TGCGCCGCGCTGTGGCTAGTCATGTTATTCCGTCGGGGCCAGATCTTGAT
AAGGCCCGCGGTTGGCTAGCTGAAGCAACGCGCCCAGTCATGATTGTTGG
CCTTGATGTACTCAAAGACAAATCGAGCGAGACAGTGCGCGCCTTTGCTG
AAATTCACAGTATTCCAGTGATCACGACATACAAAGCAAAGGGCGTTTTG
CCTGAAAACCATCCAATGTCTCTGGGTGCTGCTGGCCTGTCACCATTAGC
TGATAAACACTTGCTGCCCTTCGTAGACGAAGCTGATTTGGTGATTTGCG
TTGGGTATGATCCGATTGAAATGCGCCCCGGATGGCAAGACGTTTGGGAC
CCGATGGTCACGAATGTAATCGACATTACCGCTGCCCCGAACCACCATTT
CATGCATCAAGCAACGCTAAGCTTTATTGCCGAAACTGGTGCGACTTTAG
CCACTTTGTCTGAGGGCATCGCGCCCTACGCAACTTGGCCAGACGGCGAA
GTCGCTGCCGTAAAAGGTGCGTTGGCGAATGCGTTCCCACGTGATGAAAC
TTGGGGTCCAGGCGCTGTGATCGCCGCGTGCCGCGATATGCTGCCTGCGG
ATACTATCGCGACAGTGGACAGCGGCGCCCACCGGATTTTATTGTCTCAA
ATGTGGGAATGCGCGGAACCACGCACATTACTTCAGTCCTCTGGTCTGTG
CACAATGGGCTGCGCTGTGCCGTTGGCCATTGGTGCAAAGTTAGCCGCCC
CAGACCGCACAGTCGTTAGTTTTTCGGGTGATGCAGGCTTGCTGATGGTC
GCCGGTGATCTGTCGACAGCCGCTGAAAATGCCCAAAACACGATCTTTGT
TGTGTTCGTGGACCAATCGCTCGCTTTGATTGAATTGAAGCAGCGTCAGC
GCCAGTTGGCACACCGAGGTGTTGATTTCCGAGGGCATGATTACGCCGCG
ATTGGCCGCGCCTTTGGCGGGCATGGCGTCACCGTGACCAGCCGCGAAGA
ATTGCACGCTGCGTTGAAAGACGCGCAAACTGCCGACAACTTTACCTTAA
TCGCCGCTGTGATTGATAAGCAGTCTTACGACGGGCGTATCTGATGGCTG
GCGCATTAGACGGGCTGCGCATTCTGGACCTGACTCGGATTCTGGCAGGG
CCGACGTGTACGCAGCTGTTGGGCGATTTGGGCGCTGAAGTGATCAAGAT
TGAGAACCCAGCGACAGGCGGTGATGACACGCGCAGCTGGGGACCACCGT
TCATCGAAGGCCCGGATGGAACACCCACAGACCTCAGCGCGTATTTCATG
TGTGCAAACCGGAACAAGCTGTCCGTTTCCGTCGATATCGCAACCAAAGA
AGGACAAGATACGATCCGCGCTTTGGCAGCCCAATGTGATGTGATGGTCG
AAAACTTCAAACCCGGCGGCCTAGCGAAATATGGTTTAGATGCAGAGACA
CTTTTGCAGTCCGACCCTGCGCTGGTCTATTGTTCAATCTCTGGGTTTGG
TCAGACCGGTCCAAACGCGAGCAAACCCGGCTATGATCTGATGGCCCAAG
GATTTGGTGGAATCATGTCGCTGACAGGTGATCCTGCTGGTGAACCGATG
AAGGTTGGCGTCGGTGTCGCGGACGTCATGTGCGGGATGTACGCAACGAT
TGGAATTTTGGCGGCCCTGCGCCACCGCGATAAGACCGGCGAAGGACAGC
ACATTGATGTGGCCCTTGTGGACAGCCAGATTTCTTGGTTGGTCAATGAA
GGTGTGAGCCATCTCACCACTGGTGATTTACCAAAGCGACGCGGGAACGG
ACATCCCAACATCGTGCCGTATCAGGTTTTTGCGACCAGCGATGGGCATG
TGATCATTGCAGTGGGCAACGATACGCAGTTCAGCCGTTTCTGCACGTTT
CTTGGGGTGCCACAGTTGGCGCAAGACCTACGCTATGCAACTAACCCTGC
GCGATTGGAAAACAGAGACAGTCTTTTGACGCAGATCGTTCCCTTGATTG
CCGCTAAGCCGATGTCTGACATGATTGATGGATTGGAAGCGTCGAAGGTC
CCAGTTGGCCCGGTCCAGACCCTCGACCAAGTATTTGGCAGCGAACAGGT
TAAAGCCCGTGACATGATTGCGACGATTCCCACGGATGACGCAAAGGCAG
GTGAAGTGCGCGTTATCGGGAATCCGCTGAAACTTTCGAAAACGCCTGTA
ACCTACCGGCGCGCGCCGCCACGCTTTGGACAGGATACAGACGCAGTTTT
GGACAAAATTCAGCCTAAACGGTGAAAGCACAGGCACTTGAGGCTTGAAA
CACCGGTAACAGGTCCGTCATTCACGGGTCTGTGAGATATATAATTCGCA
AAGTGCCTGTATGTCAGGATTAACGAGAGCGCAGTTTAGCTGTGTTGTAC
TTTTTCTAGAATTGGAGGCATGCATGACGCAGGATATTTTTGGGCAAACG
ACAACCGTTGCAGCAGGCCCAGCGCTTGAGACTTGGAACAAAACCCAGAT
GGCGTTCTTGGCGCATGGAGCAGCAACCCCTGTTCACTTGGGTGAAGTCC
TAAATGTGGCCCCCGATTTTGCTCTTGCCCAAGCCGTGAAAGGCATGTTT
TACACGCTTCTTGGCCGCCGTGAATTGATGGACACCGCGCATGAGGCATT
GGCAACTGCGCGCGCCGCCGCAAAGGCAGATCCCGTCAGTGCCCGCGAGC
AACATTTCATCGACGCGCTTGCCTGCTGGGTTGCAGGTGAACCAAAAGCT
GCGCTGGTTCATTTTGAAGCGGTTATTGCTGAAGCCCCTGACGATATTCT
GGCGGTAAAGCTTGACCACGCCACACGTTTTGTTCTCGGTGACAGCATCG
GCATGCGTCGAATGTTGGAACTGGTGATGCCTGCCTATGGGCCTGATCAC
CTTGGCCGAGGGTATTTGATGGGGTGCTATGCCTTTGCCCTTGAGGAAAC
TGGTGACTATTCCCGTGCGAAATCTATGGGCCGTGAAGGCATGCTGATTT
CCCCTGACGATGCGTGGGGCCTTCATGCTGTTGCGCACGTCCATGATATG
ATGGCTGATGCGGCTGGCGGGATCAAATGGCTTGATGGTCGTGAAAACGC
TTGGGCGCATTGTAACAATTTCCGCTATCACGTGTGGTGGCACAAAGCAC
TGATGCACCTTGATCTGGGTCAGCACGATGTTGTTCTAGATTTGTATGAC
CGCGAAATCCGTCAGGATAAAACTGACGATTACCGTGATATTTCAAACGC
AACATCGTTGTTGTCACGGCTTGAATTGGACGGAGTAACCGTTGGTGATC
GCTGGGAGGAATTGGCCGATCTGTCAGCTAACCGAACCGAGGACGGCTGC
CTTATTTTCGCTGACCTGCACTACATGCTGGCACTTGTTGGCGATAATCG
TGAGGCTGAGGTCACGAAATTACTGGGCCGGTTGCACCGCGATGCGAATG
AAAGCAAAAATGATATGCAAAAAGCGATGGCCGCGCCCGGTCTTGCTGCG
GCGGTTGGTCTTGAGGCATTTGGTGAGGCTGAATTTGACAAAGCCTTCGT
CAATTTGGTCCAAGCCCGCAAAACAATTCAAGATGCAGGTGGTTCACACG
CACAACGCGATGTATTTGAACGTTTGACTATCGACAGTGGTATCCGTGCT
GGATATTTGAACGAAGCCGAAGATATCCTCGCAGCGCGAACACTACGCCG
CAATGGCCATGAAGATGGGTATGCCGCCGCTCGCCAATCGTTGATTTCTG
AGGGACGTGCTGCCGCCGGTGTCGCAGCCCGATTTCCAGCCCAATAAGGT
TGGAATCAAGGACGTTCATTAAGATGGCCAACGCCACACAGTCTGACATA
CAGCGCGTACGTGACCCGCGGCTTGATTTTTATCGCGGTATCGCGATGCT
CATTATCTTCACGTCACATACACCGGGCAATTTCTGGGGTGACTGGATTC
CCGGCCGCTTTGGTTTTTCCGACGCGACTGAGATCTTCGTGTTCTGTTCA
GGCATGGCGTCAGCAATTGCGTTTGGCGGAAGCTATGACAAGCGTGGCTG
GATGTTGGGCACCGCGCGCGTGCTTTTTCGTTGCTGGCAGGTCTATTGGG
CACACATCTGTCTGTTTCTGGCCATCGCCATGATGTTGGTCACGATTGAC
CTGTTTGAGTTCGAGAAAAATTACGTGAACAGCCTCAACCTTGGTCGGTT
CTTTAACGACACCAAGGATCAACTGTTTGGCCTTTTGACCCTGACCTATG
TGCCTAACTATTTTGATATCCTGCCGATGTATATCGCGATCCTTTTGATG
ATGCCCCTGATTATGGCCCTATCAACAGTCCACGTTAGCCTTGTCTTTGC
GTTCTGTGCCGCCCTTTGGTTCATCGCCCAAACCCGGATCATGATTGCGT
TGGGAATTGAGCAATTCGCTGTTTCTTTGCCTGCTGCGAACTACAGTGAT
CGACCTTGGTTCTTTAACCCGTTTGCGTGGCAGCTTGTTTTTTTCACTGG
TTTTGCGTTAGTGCGCGGCTGGATTCCACGGCTACCTGTCAACACCGTTT
TGATCGTTTTGGCGTCCATCATTGTGCTCGGCATGATGACCGTGTCCCAT
GTTGCCATGCGCGAATGGGGCTTTGAATGGGCGCGTGATTGGCGCACTGC
GAATACTGAGTTCGTCACGAAGACTGACTTTGGCATTGCGCGCTACACGC
ACTTTCTGGCCCTTGCCTATTTGGCCTACGCTGTTGCGGGCGATGGTGGA
CGGCGTTTGATCATCACAGGTCAGTCTTTGGGGGCGAACGCTGTGAAAAC
GCTTGTCACAGTGCTCACTAAAGTCGGCCAACAATCGCTTGCCGTATTTA
TCGTTTCAATGATGCTCTCGGTCTTTGTGGGATTTCTTTTAACTGAGACT
GGCGCGACTGCTGATGACGTCACTACCATAAAGTCGCACACTTACGTCGC
CGCTGGGAATATTCTTGGCTGGGTTTTCCTTATATTTATCGCTTACACAG
TTGCATGGTTTAAAAGCCAGCCTTGGAGAAAGTCTGCTACAGGATGATTT
CACGTCGCGCCCTTTTGGTCAGCATGGCCGCCGCTGCTGCAACGCCTTCT
TGGGCGAAGCCTGAGTTAGTTATTGCTGAAACCCCCTTTACTGCAAATTT
GGTCGCAGACATGGCCCGAGAGCTGGCTAAGGCCGATTACGTTCCCGCTC
TCCAGATTCCGCAGGAATGGCTTGATCTGACCTATGATGAATTTTCGCAC
ATCTGGTTTGATCCGCGCAACGGGATTTGGGTGGATGAAGATCGCCCACT
GAAAATGGACCTGTTTAACGCAGGTCTATATGTACCGCGCCCAGCTGAAG
TGAACCTTGTTGAAGGTGGCGTCGCTAAGACCCTCGGCTTTGATATCAAC
CTGTTTGCAACGACTGATGAATTTCCAGAACTACCGATTGGTGACACGAT
GGGGTATTCTGGATTCCGACTGCGGGCTGCATTGACGACACCTGATATCT
TTGAAGAATTCGTTGTTTTCCAAGGCGCGTCCTATTTCCGTGCGATTGCG
AACGGCCAGAATTATGGTTTGTCTGCACGGGGTCTTGCCCTACGCACAGG
TGACCCAGACGGCGAAGAATTCCCCGATTTCACAAAATTCTGGGTCGAGG
CCGCATCCCCCGGTGATACCGAATTTGTCATTCACGCCTTGCTTAACGGG
CCATCGACAACCGGCGCGTACACCTTCCGTATTCAAGCAGGCGACAAGGG
TGAGCCGACAGTGATGAACGTCGACTGCACCCTGTTTCCTCGCGTTGATC
TGACGCATGTTGGACTGGGACCACTCACGTCCATGTTCCTGTTCGACGAA
ACAAACAGAAATCGGTTCGACGACTTCCGCCCGGCTGTCCACGATAGCGA
AGGACTGCTGATCGTGAACGGCAATGGCGAGAAAATCTGGCGACCTTTGG
CGAACCCCACCAGCGTGCAGGTATCGTCTTTTACCGATGAAAACCCCCAA
GGGTTTGGCCTGATGCAGCGCAACCGCACTCCCGACGATTACGCAGATCT
TGAGGCCCATTACGAAAACCGCCCATCCCTTTGGATCACACCAAACGAAG
GCTGGGGCAAAGGTGTCGTGGAATTGGTTGAGATTCCAGCAGACTTGGAA
ATCTACGATAACATCGTTGCCTATTGGCGCCCCGCTGACCCAATGATGAC
TGGCACTGAACATCGCTTTGGTTACAGCATGAAATGGGGCGACGAACCCG
CTGGTTTGCCGGACGTCGCACGCATCACGAATACCCGTATAGGCAAGGGG
TTCGATCAGGTCAAAACCGTTATTGCCATTGATTTCACAGATCATCCTGA
CCTGCCTGAAGACCTATCAGAGGTCAGCCTGACGATCCGATCAAACAACG
GTGAAGTCTCGACCGGCATTCTTCAGCGCAATCCGGGAACTGGGGGCGTG
CGTCTTGCGTTCTCATTGTTGCCGGGTGATGCGCAAGCCGCTGAAATGCG
CGCCCAAATGCACATGAATGGCACCACCATCAGCGAGGTTTGGTTGTATA
GATGGACGATTTAGGGCCACATCCACACGCAGGATGGATGCCATCTGCCG
CAAGACGAAAAATGCCAATCCAAGCGTTGGATCAGCCTTATCATGACGCG
ACGGCACCTCAAACACGCGCCGGACCACGCACTGTCTGGTGGCGCGCAGC
TACGTTTTTGCCCCCGATTGCTGCTACCACTGCCCTAATCGTAGCCTTCA
CCGACTGGTTCGCGATGGACGGTTTTTCGGCGTTTGAGGGCGTTGTGATC
ACTTTGATCGCCTTCACGTTCTTTTGGATCGCGCTGTCCGTCAGCACTTC
ATTCCTTGGCGTCGCAACCTTGTGCCTATCACGTCCACGCGCAGCCCTTG
ACGGCCCAGTTCCGCCAATGAACGTGGCGCTCTTAGTCCCTGTTTTTAAC
GAAGACACCGCGGACGTGTTCGGAAATGCCGCCGCGATGCTGTCCGCCTT
GGGTGAACAAGATTTCGTCCACAATTTTGACCTGTTCATCTTGTCAGACA
CCCGTGATGCAGCCATCGCGGCAAAAGAAGAACGCGCCTTCATAGCACTT
CGCACGCAACTGAGCTTTGGCAGCCAAGTTTATTATCGTAGGCGTGCCGA
CAATGTAGATCGCAAGGTCGGCAACCTTGCCGATTGGGTCGAGAATTGGG
GCGGTGCCTACGAAGCCATGCTAGTGTTGGACGCAGATAGCCTAATGGCA
GGCGAAGCAATTGTTGGGTTGGCCGATGCGTTGGCCTATGATCCCTCGGC
TGGATTGATCCAATCTTTCCCAACGTTGTTTGGCGCACAATCCGTTTTTG
GCCGCGTACAGCAGTTTTCAAATCGCGTATACGGTGCGGCTTTGGCCGAG
GGCCTTGCCAAATGGACTGACCGCGAGGGCAATTACTGGGGCCATAACGC
GATCATCCGGTCCGCTGCTTTTGCGGCCTGCGCGGGATTGCCCAAGGTTG
GCAACCACAAGGGCAACGGCCGTCTGATCCTCTCACACGATTTTATTGAG
GCAGGATTACTGCGCCGTGCTGGCTGGTCCGTGCGTTTCTTGCCGCGCAT
CGGGGGGTCCTATGAAGAGGTCCCGGCGACTCTGATCGACTACGTTCTAC
GCGACCGTCGCTGGTGTCAGGGCAACCTGCAACATCTCAGGCTACTTGGC
TCGCGTGGTTTCAATGCGGTGTCACGCTTCCACCTGATTAGTGGGGCGAT
GGGTTATCTCATGTCCCCAGCTTGGTTCGCTTTGCTTCTCGTCTGGACGC
TAATTGGTAACGGCCAAGAGACGAACGCGATCCGCTACTTTTCTGGCTTT
GACCCGCAGGTTAGTTGGCCTGTGATCAGCACTGGAAACTCCCTCGCGAT
CCTCAGTTTTATGTACGGGATGTTGCTGGCTCCAAAGTTGATGAGCGCAG
GTGCGGCCAGCCGTTCGGGCATCAACATGCGCGACATGGGCGGAGCATTT
CAGTTCCTTGGATCGCTGTTCGCTGAAATTCTACTGTCGATCCTTTTTGC
TCCAATCATGATGGTGCAGCAAACGATTGCGGTAATACGCACAACAATTG
GCTACCAGGAAACATGGACGCCACAACAACGACGTGGGGGTCAATACAGC
ATGTTGATCATGCTCAAGTTCCACATTGTGGAGACGCTAATGGGCGCTTT
GATGATTGCAGGTATGGCCCAAGGTCTTGTGACACTGTGGCTGCTACCCA
TTGCAATTAGCCTGATTGGGGCGGTCCCACTGTCTGCGTTCAGCGGAGTA
AATCTGGGGGCAAAAGGATGGTCGGGGCGTCAAATGGGCACACCAGAGCA
CCTAAACGCGCCGCGCATTATTCGGGTTGCGATGGCGGAACGTCAGCGAT
TTGCAGCAGTGCTTGCGGCGCCTGAAACTAGGATCGCAGCAGAATAGGGC
TAGGTGGTTATGCCCTCGCACAAGTCATATGGGTAGGCCGACCAACGGCA
TGAGATGCCGGGGCCAATGGGATCTAGGATGCGTTAGAGGGCCGTACCCG
CATCGCATTTGTTCTTTTTACGAACCCCGAAACCACCCAACGCATCAAGC
GGATCTGCGCCAATATCTCAGCAAATTACCGTTTTCCATGATCGAGCGAG
AGTAGCCGATCTTCATTCCGCACGCTCGCTGAGCCTTCATCGTCTCCACC
GTGCCAAGAATTAGATCAGCGTAAGCGGCCGCCACATTGCCCGAATGTGA
CCCTCCACGAATGAGGTTAGGGGCGCCCATGATAGTAGCGATCCCATGTG
CGTGACAGGCGTCTGCAGCTTCAACAGTGGTTGGAAACTCGGCCATGGTC
ACGCCATATGCTTGACTTGTTGCCACCTGCTCGGACGTCGTGTCATCATG
ACTTGCCAATGTGGCGCCTAACCGTTTGGCAGCATCAACCGTTGCCGTCT
CATGGCCAGCTCCAAATTGCGATTGAAGCCCATAAAGAAAATCCACGTAG
TCACGGTATTCCTGATCTCCAAAACTGTATTTGCCACGTGTATAGGTTTC
GAACTTGGACAGGTCTGCAAATTGCCGCTGACCCGGTGTGTGATCCATCA
TCGACACAATACCTATCCGGTCTTCGGCGGAAAACGCTGCAAATTCTTCG
GCTAATGTTTCAGAACAAATCTCTGCACGCAGATGAATATGATGACTGAT
CCTGAGCAGGCCACCCTCCCGCATGCCCTGGATCTCATCGGCCATTTGCC
GCGCATATTTACCATACCGCTTACTGGCGCCAGATATGATCGACCCGACA
CGGATTGCATCAAAAACTGTAGTGATGCCAGTGCCAGCGAGTTCGCGATC
ATGGGCCAGAATTGCAGCACGGTATGGCCAGTCTACCTTGGGGCGCGGTG
TAAGATGGCGCTCAAGATTGTCAGTATGCAACTCGACCAAACCGGGGGCG
AGATAATCACCCCCAAGGTCAAACGCACCTGCTGGCACCGACGTGCCGCT
GTCGATGTCGATGTCGATGTCGGAAATAACGCCGTCCTTAAGCCGTACGG
AGCCTCTGACGACCTCGTCATTTAGAATAAGGGTGGCGTTAGCGAAAATA
GTTTGCTCTGTCATGTCAATGTCACGCGGGTTTGGCAGATGAAAGCATCT
GCGGTGGAGATCAAATGTTTGAACGATATGCTGTATTTTTTACGCCAATA
GGCCCGTTGACCGCTTGGGGTAGCGCTTGGTTGGGATGGGACAGTGCAAA
AGGCCGCTGCGTTCCAAACCCCAATGGCACAGGTGTCGACCTCGCTTGGA
TCACAGCCGCGCCACGCCAATACGGGCTTCATGCTACGCTGAAAGCACCG
TTCAGGCTCGCGCAGGGCGCGAGTTTGGAACAACTTCAGCAAGCCGCAAC
CAAATTTGCCAGCCAGTACGCTGCTTTTGACATCGGTGCGATGGAACTGC
GGCACGATAGCGGCTTTGTCGCACTGCGCCCAAAAAGTACTCCCAAGAAA
TTGCACGATTTTGCCGCCAGTACCGTCAAAGCGTTTGACCCGTTCCGCGC
GCCGCTGACGGACACTGATATTACCCACCGCCGCAAAGCGTTGATGACAG
CCCGTCAAGACCAACAGATGCTGGATTGGGGTTATCCTTTTATTTTCGAC
GATTTTCATTTTCATCTGACCTTGAGCGGCAGCCTGCCACAGCCACAGGC
AGCTGCTGTAATCGCGGCGTTGACGCCGGACTTGGAACCTATGATGCCGA
CCCCTTTCGTGATCGACGCGATCACACTGATGGGACAAGACAGCGACGGC
ATGTTTCACCAAATCCACCGTCATGCCTTGACCGGATAAAGGCAGTCGAG
CGCGACTTGCACAGTTCCCTCCAGCGCCCCGGTATTATCAATATCACAAA
CTGTGATGCCATCTGGCAGCCGCACAGAAGCACGATCAAGGCGGTCAGTG
ATCTGATCTGAGGTTTCTCGGCTGCGCGCCGCTAAACGATCTGCGAGGAT
ACTGCGATCGGCTGTTAGTTTGATCACTTCAAACCGGGCAAAATAGCCTT
GGGCGCGTTGCAAGGCATCACGCGACAAGTTTGCCAAGACATCTTGCCCA
TTTTGCAACTGCGCTTTGACAGATATTGGTATCGCATAGTGCAACCCGTG
CGCAGACCAGCTCAACGCGAAGTGTCCTGCAGCCTGTCTCTTTTGAAATT
CCTCTGCTGTGACACCTTCAAAAATCTCTCCGCCCGCGTCGCTGTGGCGG
GTAATGACACGTCGGGTCAAAACGATGCGCGGATCGCGGGCGGCCATGGC
TTCCATAACGCTGTCTTTGCCCACGCCCGATGGTCCAACGACAGCGATAA
AACGACCGCTCATGATGCCATCCCTGGTGTATATCTGGTCACGTCTAGCT
GACGGTCACAAGTTTCTTCACGGGCGGCATGGTCATGGAAAATTCCGATG
ATGGCTGCGCCACGCAATTTGGCTTCGCTAATCATCGCGAGGACTGTCGC
GCGATTGGTCGGATCCAAGCTTGCTGTCGGTTCATCCAACAGCAACGCTG
GATATGGATATGCAAAGCCACGCGCAATGTTGACCCGCTGCTGTTCCCCA
CCGGAAAAAGTCGTGGGGCTGAGCGACCAAAGCCGTTCGGGAATGTTCAG
TCGCGCCAGTAGGTTTTGTGCCGTTCGGATTGCATCCCCATGCGGTGTGC
CTGTCGCAAGCAGCGGTTCTGCAACAACAACAAGAGTTGAAACACGCGGA
ACAACACACAAAAACTGACTCACATATCCCAATGTATGACGGCGCAGATC
AATGATTTCGCGTGGCGCAGCGGCTGTAACATCCACGTCCCCAATCATAA
TACGACCAGAGGCAGTAAGGTAATTGCCATAGATCATCCGCATCAATGTG
GATTTTCCAGCGCCTGATGCCCCGATAAGTGCGACGCATTCGCCCGCAGC
GACATGCAGTGATGCGCCCTGCATGACTGGGATTTCTGCAGCACCCTGAT
TGTGTAGAACAAACGACTTAGAGACATTTTCAATAGAAATCATAACGTCA
CACCTGCAAAACGGAGGAAACAAGAAGTTGGGTATAGGCATGTTGCGGAT
CATCTAGCACCTGATCGGTCAGACCCGTTTCAATCACATGCCCGTCCTTC
ATCACCATCAGCCGATCCGCCAGCAGGCGCACAACCGCCAAATCATGGGT
CACGATGATGGCACTTAAGTTCATTTCGCGCACAAGTCCGCGCAAGAGAT
CCAACAGCCGCGCCTGCACCGACACATCCAAGCCGCCCGTGGGTTCATCC
ATGAATACCAACCGTGGCCCCGTCACCAGATTACGTGCGATTTGTAGGCG
TTGCTGCATTCCACCGGAAAAGGCAGTGGGACGATCATCGATCCGATCCT
CAGTGATCTCGACGCGACCAAGCCAATCGATGGCAGATGCGCGAATGTCA
CCGTAATGACGGGCATCCACAGCCATCAGCCGCTCACCGACATTTCCGCC
GGCACTGACGTTCATCCGCAGACCGTCACGGGCATGTTGATGAACAAAGG
CCCAGTCTGTCCGGCTTAGCATCCGACGTTCAGGTTCACTCATAGTGATC
GTGTTACGCAATCCATCAGCGCGGGTGTCAAAGCGAACTGCCCCCGCATC
AGGTGTCAAATGACCCGCAAGACAGTTCAACAAAGTGGACTTGCCAGACC
CGCTTTCACCCACAATGCCCATGACTTCGCCGGGATATAAATCAAACGAT
ACATCCATGCAGCCAATGCGTGCCCCATAGAACTTCGCGATATTCTCAAC
TTGCAAAAGCGGGGTCATGCCGCGTCCTCCGCGTAAGGCACACCTTGCGC
ACCCGTGTGACCTCGTTTGCGGCGCATGCTGCAATAATCCGTGTCAGAGC
ACATGAACATTCGGCCCCCGTCGTCATCCATAATCAACTCGTCGAGATAA
CTATCAACCGCTCCGCACAGATCGCAGGCATGGTCGGCTTTCGTGGGTTG
AAACGGATAATCGTCGAAATCGAGGCTGACCACTTTCGTGTAAGGCGGGA
TGGCATAAATACGCTGCTCGCGCCCTGCCCCAAACAGCTGGATACCCACC
ATCTCAAGCTTTGGGTTATCAAATTTTGGAATAGGCGATGGGTCCATCAC
ATAACGTCCCTCAACCTTTACCGGATAGGCGTAGGCAGTGGCGATATCGC
CGTGCTGGCTGATATCCTCGTAAAGTTTTACATGCATAAGCCCATATTCT
TCGAGGCTGTGCATTTTGCGGGTCTCAACCTCAGAGGGCTCTAGAAAGCG
CAATGGTTCAGGGATCGGCACCTGATACACAATGATCTGATCACTGCGTA
GGTCCTGTTCGGGGATCCGGTGACGGGTCTGGATGACGCTGGCGTCTACA
GTGGCTTCAGTCACAGCAATGCCTGCAGTCTTTTGGAAAAATCGGCGGAT
GGACACCGCGTTGGTTGTGTCATCCGCACCTTGTTCGATCACTTTGAACG
TATCATCTGGCATCAAGACAGCCGCTGAAACCTGCACCCCGCCCGTACCC
CAACCGTAAGGCATCGGCATCTCGCGGGATGCAAATGGCACCTGATAACC
AGGGATGGCTAACCCTTTCAGGATAGCACGACGGATCATACGTTTGGTTT
TCTCATCCAGATAGGCAAAATTATAGTCGCTCATTCTGCGGCCTCCTGCG
CGATGTTTGCTTGCGCCTCGCGACGCAGCTTGCGGATCAATTCCAGCTCT
GATTGAAAATCGACATAATGAGGCAGCTTGATGTGTTCCAAGAACCCCGT
CGCCTGAATGTTATCGCTATGATACAAAACAAATTCCTCGTCCTGCGCTG
GTGCGCCAAGGTTATCCTCGCCCAGCTCTTTCCAGCGCAATGCGCGATCA
ACCAACGCCATTGAGATCGCCTTGCGTTCCGTCATGCCAAACACCAGGCC
GTAGCCCCGGGTAAATTGGGGTGGTTCAATCTTAGACCCTGTGAACTGAT
TGACGGTCTCGCATTCAGTCACCGTGATTTCTCCAGTCTCAATGGCAAAA
CCCAGCTCTGGAATGTCCATTTCCACGGGAACTGCGCCGATGCGCAGCTC
GGCCACAAAGGCATGGTTGCGCGCATAGCCGCGCTGCGTCGAATAGGCCA
TGCCAAGGATAGACCCTTCATCCGCACGCGTCAGAGACTGCAACCGCAAC
GCGCGGCTCGCTGGCAATTCCAGAGGCGTACGCGTCAAGTCTGCAGGCGT
TTGGTCACCGCTTGGTTCAGACTGGATCAGGTTCTCACGATCAAGAAAAG
GCATAATATGAGGGGTGGAACGCCAACCTTGACCGTCCTCGCCCTGAGAC
CGATCCATTTTCGCGCCAGATCATTTTCAGCTTGGGATGCTTTCTGGAGG
TGTTCCATCTTGCAGCGACCAAGCAAAGATGCGGGCGGATATCACGCCGT
TTCAGATGGCAGCGATCCAGAACGTCTCAGTGCCGACGCGCCCATCGCGG
GGTCCGGATCATTCAAGACCAAAGTTTGGCACCCGATCCATTGTTCGACC
AAGCGCTAAGTTGCCGCACAAACCGTGCCACCTTTGATCTGAGCAGACCC
ATCTCGAACATTAGCCTCACATTTCTAATAAATGCGGCTCAAACTCCTAA
TTGGGTTGGACATTCCAACATGGTGCGGATGCTGGATAAAATCCGCACTC
CGACAGCGATTCATGGCGTGTAGAGTGCGACGCGCGCCACAACCGTGAAG
AAAGCAATAGGATCATGCGCTTTACAAAACAGGAAGTCAGTGACGACCCT
TGGGGCCTGGCGATCCCAAGCGTGAAAATAGAAACCTTGAATGCGACAGG
TATCATGACACGCAAAAAAATGCTTGAAAAGAGAACGATACCATATAACA
GCAGCTTGAATGTTGACACTGATGCTTCGCCTGCGTTCTTATGGCTGACC
ATCCCGAAAAATGATCGGTTCGCACAGATCGAAACGGCGAAAGCTCGGGT
CAGATTGCATCTGAAAGCAACCGAGCTGGGACTGGGGTTTCATCCCCGCA
ATCAGCGATTCAGGAGTGTCCTGCAATGTCAGGACACTATGAAATAGCCT
ACTATAGGCTGGCGCCGACGGGTGGAACAGTCCATATCTTGATCCGTCAA
GGCTATGCCGCAAGCCCTCCACCTGCTCCCAGAAAAACCCTTCAAGCAAA
GCTCATTGGGGCTTGAGGCGGAACGTCAACAGGTACTTAAAGTAGCCACT
CGGGTACGCGGCTATCGAAGCTATGCTATCCAGTCAAAACACCACATTTT
TATCAAGGTGACTAGGCTTATTCTATTGCGAGTATCCAATTTGCAATCTG
ATCAATTGATATCTGAGCGTGGGCATCTCGCCCCAGATTGCAAGCACTGG
ACCAATCATGCCAGTAGAGTCTTCCCAATATGCATCAGCAACGAACCTGA
ATCACGCAGTGTCCATGTATGTCGTCAGCGTTTGTGCAGCGGGTGTAGCA
AACAGAGCATCGTTTCTGAGAATACGATCAGCCAACCGCTGCTCAATCTC
CTCTTGTGGAACGCCCTCTGACATCATTCTCATGCGGCTGTAATAAGTCC
CCTGATTACGCCAAGACACGGCCCCACCGACGGTCACTGTGAATGCTGGT
GTTGTTTGATTTGCGACGCGTGGAAGAACTCAGCCTGCCTGTGAAAACCC
CAAAAAACCAATTTGATTGGCGTTTATTCCGTCCTCTGCAGAAATAGCCT
GTCGTGCCACCAACGCCTCTTCTGCGCGGTCTTCCATGGTTTGGTCCAAC
CAGTTTCCTGTGCTCTCTCCAACGCCTGCCTTGTCCCAAGAAAAGACCCC
AATTCCAGATTCAACCAGTGTGTTGATCATGGGGAGGTATCCTCCATTGG
AAAAACGATGCTGCGCCCCGTCTCCATGGACGATAAGGGCGATCGGTGGG
TTCGTGGCATCGCTGGGCATCACCAATGTTCCTGATAACACCGCGTCATC
GAGTTCAAACGAGACTTCCCTAATGCTATGTCCAGTGAGTTCAAAGTCAG
AGAGGCCGCGCACCGCCCAAAATGCGGCTCCGATACCTATGACGAGCATC
ACAAATATCAGCCTAAGGACATATTTTCTCATGCCTTCGGACCTGACTTG
TGACCAGTTTTGGAACTGAAATAACTCGGACGCCAGGATAAGCCGCCAAA
GATGATCCGCAAACGATCACCCATCGTCCTGCACTTCTTTACGTCTTGCC
AGATGTTACCAAACTCTATGAAGATAATCTTGACCGGGTTGTTGGTATTG
ATGTCGCGCGTCAGCCCGTAGATCACCTTTTCTTCTTCACGTGCGAAGGT
TCCGAAAAGCTTGTCCCAGATCATCAAGATACCGCCGTAATTCTTGTCGA
GATATTGGCGGTTCGACCCATGATGAACACGGTGGACCGAGGGTGTATTA
AATACTTCATCCAACCAGCCCAGCTTTGTGACCCGTTCCGTATGTACCCA
GTGCTGATACTGCGCAACGAGCACCAAGCCGACGATGGCCTGAAATGGAC
TGAAGCCGATCAGGATCATCGGGATCAGGAACGCCCATTCAAAAAAGCCT
TCCACCAGGCTCAATCGAAAACCCACGGTTAGATTGTAGTCGTTCGAGCT
ATGATGGACGCTGTGACTGGCCCAAAGGATGCGGTGTTCATGCTCAAGGC
GATGCATCCAATAATATGTGAAGTCCGCAGCCAGTAATGCCAGCAGCCAT
GTCCACCCAGTCATAGGAATGGAAAGTGGCGTCAGATAGTAAAACGGCAA
CAACGCAATAAACCCGAGCGAGGCGAATGCAGTCTTTTCGATAACCTGAT
GAGCGGTGAAGATGACTAAGTTTGCCATTGTGTCCTTCCAGCGCCGCTCT
TTAGAGGTGACTAAATCCAATACAATCTCGATTCCAGTGATTGTGAGGTT
AATGATGAACAGTGCGGCTACAATCCACATGATCTGGTGTAGTTCAAAAA
ATGCGACAAGGTTATCTATTGTCATGGGAAGCCCTTTCTTAGCGACTCAC
TTAATGTTACGAACGAACGATCGTTCGCTACCTAGAATTCAAATACAGGA
TCGTCAACCCATGTCCGCTGACCCCCACCACATACACCCGCGTAAGCTTG
AAATAGTGCATGCGGCGGTCACCAACTTTCTCGAAAAAGGGTATCACCAG
ACCGGTGTGCGCGACATTGTAGGACAAGCAGGCATCAGCCTTGGGAACCT
CTACAACCACTTCAAAGGCAAAGAAGCGATACTGGTCTTCATTGCCGAAA
TTGAAGGACAGGAATTGTCAGACTTCATTGACCGGCTGTCGTCTACCGAT
GATCCGCGTGCAACGCTGCAGTGGTTTATCACGGATTACGCCGCCTACGT
AGCGCTCCCAGAGAATGCATTGCTTGGTGTGGAAATACTGACTGAAGCAT
TGCGCAACCCAGCCATCGCCGATGTGTTTGGTCGCAACCGTGACCGGTTA
ATTGCCGCACTCGCCGGTTGCCTCACCCAAGGGGGTAAATCAGGTGTCTT
TGCCTCCCTGATAGACCCACGTGTGGTGGCTTGCATGATCCTTGACACAT
TGGAGGGCCAAGGCTTGCGCAGCTTGTCGTTGCCAGCACATAGCAACCTC
GCACCGGATGCCATCGGCTCCTTCATTTTGAACGGTCTAAAACCCTGACG
CCTGAAGGCCCTAAGAGCAGAAAGTCCAAGGCCTGCAATGGCCAGCCGGC
TCAACTGGTCGACGCAACACACGCCGCAAATCTCTCAGCTGGGGTTTGAT
ATTGCGAGGTCTTGCGCGGCCGTTCGTTCAGCGGTCTCACAATTGCACTT
AACTTTGCCTGTGAAGGGACAGTTAGATCTCTCCCACACGGCAAATATTG
CCTCAGTAGCCAGTTGGTATTTTCGTTTGACCGGCGTTGCCAGCGGAACT
GAGGATCGCAATAAGAGACATCGACGTTTGCGGGCTTTCCGCTGATATAT
ATGGCGTTAATAGTCTGACCGGGGTCGTCGCGTTTGAGGCTGGCATGTTT
GGCCCGTCTGACTGCGCGCTTGGCGCGCGAGTGCGCCAGAAGCTCTTTCC
TCAGAACCCCATGCGCCTGTATATAAGGGCTTTGTTAGATCGTTTTGTGT
GACACCTATTTGTGTGCATCTTTTGGGAACGCGCGTTTGAGCCACCCCGC
AATCTGCTCAGGCGACCACTTTCGACGTAATTTTGTCGATTCTGGGTGGG
CCAGCATCAGGTGGCAAACCAGCTTACACATCAAAAGGCGCAAGCCATGA
CCGCTCGCTGGATGATCTGAGGTAGTATCTCAGTATCCAGAAGGCCCGCC
ATTCCGCCAGACCTAAGGGCTGATCGGCGCAGGTGCGCTGCCCAAATGAC
GGGCGATCATGCGCTATGATTGCTTCGCTGATCCCACGCGATATCTCTTC
ACGCTCTGACAGGCCAAAGCATACTCACCGGGTTTGCGATCTGCTGGACG
GATGCCGCTCCTGTCGGCGAGATCACCGAGGAGGACACCGGATCAAACAC
CCGCCATCGTTGCAAAAAGATTACTGCGTTGCCTGCACCAATTGCGACTA
CCCACAAAGACAAGTGTTTGCATGTCGGAGTCACTTTTTGAGACGTTCCA
AATGCATGAAGTCACGAGGAAGGTCCTAATTGCTGACCTAAACTATACAA
AATGATCTTGTCTACTGACGTCATGTCGCGCTTCTTGGAATAGGCTGCAC
TAGCGGTTGGTTTTGACAGACTATGTAATCCACCAATCGAAAGCCCACCA
AGGATGATCTGGTGACAGTCGATCCCAAAACGCGTAGCAAGATCGTCAGT
ACCTTGCTGGCAGGACGTCAGGTCGTCACGTTGCCGGGGCTGGTCGGGAT
AAAAGGACTATTTTCACGCTTTAAGCCATTGGGACCAATCACAATATTGC
CGCGTGCGTTAGCATTATCTGCGATGCGCCTAGGTTGGGGCGATCCGCTA
CCTGCACAATCAGAACTGTGCAAGACCATTTGCGCGGGTATGCCTGCCGT
TGCCGCATCAAAAACTGCAATGTGATAAGGTCACAATCGGGGCCGCATCC
AACCTTTGCAATTAATCCTATGAAGTCAGGCAAACAGTTGCTGAGAGGTT
AACTATCTTTGACAACAGGCAGTCCCCGCGCCAACCAGCCCGAGCCAGCG
GCAGAGCCAAGCATGCCTTCTCGCACATCAATAATATTCGTGAAACCCGC
ATTAATCAGCTGGTTCGACGTTCGTGCAGACCGCACACCACGTGCACAAA
TCAGCGCGATCGGGGCGTTCAAATCGCCGCCTGCTGCCTCTTGCACAAGC
GTTGCAAAATCATCAATGCGCAGGTCGATCCGGTGCGCCCCTTCGCCTGA
TCCGGTCTTTGCCCATTCATCAGGCCGACGAATGTCGATCAAGGTAATTT
CGCCAGCGACCGCCTTTGTGTGAGCCTCCAGCGCGGTCAGGATGCCACCT
GGAAAGTCTTCGGTGATCGCGCTGTAAAATAGGTTCTGTCCATCCGCTGC
GACGAAGCCACCCGCCGACAAGGCAATCAAGGCGCCAGCCCCAAGGAATG
CGCGTCTATCCATGTGTTACCCTATGTACTTTGTTATGATTGTGATGATC
TCTTCGTCTGATAAAACAGGCGGGATCAGAATGAGCGTTTTGCCTGAACT
GTCAAGAAGGTACATAAAGCTACCATTCGCATAAACAGGCCCTAATTCTG
CGTCATCAAACAAGAACTCCTTCTCGATTGAGAAGGCATCATAGGCGACC
TGCAACGCCGTGCCGGACCCAGTGAGACCCACAAAATCGTCATCGTAAAC
GGTCAACCCCGGGCCAATCGCATCAACCGTGTCGATAGTGGGATCATCAC
TGGGCGTATTGCGTGGCTCTGCGCAGCCAAATCATGTGTGATATCCACCA
TTTGTGGTAACACAGATGAACAAATCTGCAGGCAATTCGCATATCCAAAA
AACAAAAGTTGCGCACGACCATCTGGATCAGCTTGGGTATGGGTCTGCCC
ATTTTGATCGGTCAACGCATAGTCGCCTTTAACCAGAAGGCAGGCTCTGT
GCCCCTGCCACCATCGGGGTAAGGGCTGTTATCAAAGCAAGCAGCTTCAT
TCTGGAAACACCACCTCCTTTAACGCTTCGTCTTCTGCGATGCCTAGGCC
GAAGTGTCCTTCAGCAGCGATTTCAGCCAAGACCCGTGGATCGCGACAAA
ACCATGGACCTTTGCTATCCGCTCTTGGATTGTTTTCCGCCCAGTCTTTG
GTCCAACGATTGGCCGTGACCCAATCATCCTCACCGACAAGTCGGATTTT
TGAACGAGGTGGATATTCACGGCACCAAGGTCTTCGTCATAAATTTCCAG
ACCGTCCACTTCGACCTCTTGGCCGCAGTAAGGAAGCAGTTCAGCTGCAG
CACCAGTAAAGGCCGCTTGGCTGTTTTTGTTTGGGTACACGAGAACACCA
TCAACGCTGCGTAGCAGGTCCAACTGGCGATTTCCGTCACCGCAATTGTC
GGTGCATTCACACAGCATAACCACGAAGGAAGCCTCAAAACGCGTCAGGT
ATTCAGCGTAAAGGGTTCATGTCTTGGCTTCAGACCCTTCTTCGAAATTT
GTATTTTGCGCCAAAACTGGTGTCGCAACGGCAAGGATGAATGCTGTCAA
AATGTGCTTCAACATATCAAAGCTCTCACTTTCAAATTGCGAAAGGTGGG
CAGTTCCGTACCCTTTAGAATTTAATTCTTGGATATCAAGGTCGGCAATG
ACCTCTTCAACGACCAAATAGTTCAATCCATCACGCTCATAAAGCAAACC
ATCGGCGGTGACCGTGTGTCTTGCGAAGCGTAACTGGGTGTCCCCACTAG
CGCTTGCATCATCATTGCCGATCTCAAGAACCATATAAACGATCCCATCA
TCCCCGAGCAGACCAACCGGAATACCACGAGCAGAACACCAAAGCGCGCA
AGTGGGGTGCGCCGTTCCAATAACCGCATCAGGGCCGCCCATCACACCGG
AGAAACTACACCACGTGTCCATAATTTCGCCGGTGATTTGAATCAATGTG
CCTTCATCAGCGGCGACTGCCGGATTCGTGAACGCAAATAGCGTCGCACT
GATCACGCCTACCAATTTCATTTGCGTGTCCATATTGGTAGTTCGCCATT
CTTGAAAGTTTAACGCAAATTGGGCCGCATGAGGCAAATCAAATCAAAGT
GACGCCAGCGTTTTTCATCCTCACTATCGCAGTGGCAAGTGACCCGTCGA
AGTCAATCGCGCGACAAAGGGCAGTGTTCACTGTCACTTCATACCCAAGC
CCAGCAGCATCCACTGCCGAATAATTTACGCAAAAATCAGTGGCGAGACC
AACCATTGTCAGCGTCGAAATTCCGCGCGATTGCAGATACCCATGCAGAC
CAGTTGGCGTCGTGTGGTCATTTTCAAAGAACGCCGAGTAGCTGTCAATC
GCAGGGTTGAACCCCTTGCGGATGATCAGGTCAGCGGCATCTGCTTTGAG
ATCCTTGTGGAAGGCCCCGCCAATGGTCCCTTGGATGCAATGATCAGGCC
ATAAGACCTGCGGACCATATGGCATCTGAAACACGCTCATCGGGTCGGCG
TCGTGCGCGGACGCAAACGACGAATGGCCAGTGGGGTGCCAATCCTGCGT
TAAAACAACAGCGGCAAAATCCGCCATGAGGGCGTTGATACCGTGGACAA
TAAAATCACCCTCGGTCACGGCCAAAGCACCACCCGGGCAAAAGTCATTC
TGAACGTCGATCACGATGAGGGCTTGCATGGTTAATCCTTCAATAGTTAC
GTGGATTTTGCCCGATTTGTGCATAGAAGTCACCCACGGCCTTCTGATTT
TTCAGGTGAACAACTTCAAGATGCGGGTTTTCATTAACGAGTCGCTGTAA
TCGATTGCGATGAGGGTGTCGCGTGTCCCAAATCAATTTCCAAAGTGCGA
GTGTTTCGCCACTGAATTCCGCTGGAAAGTTGAGATCTGAATGTGGGCGT
GTCTGCTACCCGAGCATATGGTGAATTTGGTGCATATGATAAACCGTTAG
ACTGGTCGCATTCCCCAAAGCACGGGCAAGCGTACTTTTGACTGACCCAG
AGCCACCATTGATCATCACACGCTTCATGCACTGGTTGTATTGCGGGTAC
GCGGATTTTCCAGAGAATTCGAGCACAAGACAGAATATTTTAGGACAGAA
GAAGTATCGAGGGCTTGGCAGTCCCCGTTGTTTGAACTATCGCCGCATTT
TTTGGTGATGGAGCGCCCATGTTTCCGCAGACACTTGGTATAGATTTTGG
AACATCAAACACCGCTGCTGGCGTGATGGCAGGCGACCGGCCTTATTTGA
TTGAGGTTGAACCGGGACAGACGACCCTCCCGACGTCCGTGTTTTTTGAT
ACACAGCGCAAAATCACCGTCTATGGATCTGCTGCCAACACCGCATTGAT
TGATGGCCGCGAAGGGCGGTTTATGCGGGCATTGAAGTCCGTTCTTGGGA
CACCGTTAATGCGTGAACGCCGACAGGTTGCATACGAAACACTGACTCTG
ATCGAAGTCGTCGCCCGGTTCCTGCGCACCATTCGAGAGCGTGCAGAAAG
TGCGACAGGCCTCACGCTTAAGCACGCTGTGTCAGGTCGCCCTGTTCTGT
TCCATTCCAAAGACGCTGACAGAGATGCACAAGCTCTGATTGATTTGCGT
GAAGCGTATAGCCTTGCGGGCTTTGAAAGCGTCTCATTCGTTTTCGAGCC
GGAAGCCGCCGCACTTGCGGCTGGCAACGTGACAGGATTAGGCCTGATCG
TGGATATCGGTGGTGGTACGTCTGACTTTTCTGTCTTTACGCGTGAAGCC
GGGAAAACCAAGATTATTGCGTCACATGGTACGCGCGTTGGTGGCACTGA
TTTTGACAAAGCCATTAGTCTTAGGCATGTGATGCCCCTGCTTGGGCGTG
GTGCTGAAATCCGCAATGATATGGGACCGGGCACATATCTGGCTCCAAAT
GTGATCTTCAATGACCTCGCGAGCTGGGAAAAAATCCCGTTCCAGTACAC
AGCAGAAACGCGACGGATGGCTGCGCTTTTTGCCAGGAAAGGCCTCGACT
ACGCGGTTTTCAAGCGCCTGCAAGATACGCTTGATCTTGAGCTTGGACAT
GACCTCGCGTTTGCTGTCGAGCGTGGCAAAATCATGGTGAACAAGCCGGA
TGCAACCGATGCCGCTATTGACTTAGCGGTCCTTGAACCGGGCCTTCGTG
CGCGACTGACCGTCGATGCATTGGGTGGCGCCTTGTCTGATCATGGGGCT
ACAATCCGCACTTGCGCCACCGAAACGCTTGCCCGTGCAAACGTAGCTGC
CAGCGATATCACAACCGTTATTTTTGTTGGTGGCTCAAGCCTAATGCATG
TTGTGCGTCGTGAAATGCGTGGATTATTTCCGGATGCTGCGTTGGTCGAT
TCTGAGGCGTTCACCGCTGTGGCAAGCGGTCTTGCGATGGCTGCAGAGGC
TGCCGACAAACACCGTTAGAATCCATGTTTAAACCCTGCGTCTGGCGTTC
CCGTAAAGCAGCGCGGCACAAAGGGAAATTCGGGCGTCAAGAAATAGGCG
TAGGTCCCATTTGGATATTCAGCTGACTGGGTAAACGCACCGTTGCACGT
GTCTAAGTCCCCAAATTCCGCAACATATTCATAGTCTTGAACAAATGCGC
CGTCATAGTCGCCTGTTGGCGCATCACCACCCGGACGAGCGCCTGACTTT
AACACATAGGATGAAGCCACTTGGGTCAATTGGCCGTCCAAGATACCTGT
TAGCGCATAGATCGGATAGCCGTCAGCGGCATATCCGACCAAGGGCGAAT
GCTTGCTAGCGTCATAACGCAACAGCGCGAGCAGGCCAAAAGGCACCCCG
TGATAATGGTATGTGCCTTGCGGCTGAACATGCGCATAATTCGCGTCAAC
GCCCAACGGCACAGCCCCGCCCAGAGCATCGTAGTTCCAACCAGATCGTG
GATTACCTTGCCAGAATTCAGCAGCAAAGGGATCAAAAACCACTCCTTTC
ACAGACACACCAAATACCCAGCCCTGTGCGGATGTGAGCGACTGCGCCCG
TGTGGGGCTGAGAGGAACCTGTAGATTAACCTGCTGTTCAGAGATCGTGT
TTGGATTGCCTGGGTTAGGAAACGCCCCAACAAGGTGATCTGGAATCCCA
TTGGCAAACATCGTCCGCGCTGTCGCCGTCTTTGAAAAAGCAACTACATT
TGTCCCGGCGCGTTCGGTTGCGGCAACCGGCACAATCGGTTGTGCCTCTG
TCGCGGTATGTTCACGCATGGGCGGCCTTTGTGCGATGGCTGCACACCCA
ATTCCTAAACAAAGTGAGCCAATCAGAGTAATTTTCATAGGTATACGCAT
CCAGAAGTTCCTTAAAATCGTTACTCATACTACGCCTATAGCTAGGCTTT
CCGTCGGTACATTTTCACGGTCTTGCCCATTTCGTGTGACAAGCGTAACC
GGACTGTATGTATATTGTTGCGGCTCTTTACCATTTCACCCGATTTCCTG
ACCCAGCGTTACTGCGCGGGCCGTTGTTGGACTGTTGCCAAAACCACAAA
ATTGGCGGGACTTTACTGCTGGCCCACGAGGGGGTGAACGGCACTATTGC
TGGGACCCGTGTTGGGATTGATGCCGTCCTCGACCATTTACGTGCTTTGC
CCGGATGTATCACCCTTGAGCACAAGGAAAGCTTGTCTGAGACGCCCCCA
TTTAACCGAATGAAAGTCCGTTTAAAACGAGAGATCGTGACGATGGGGCA
ACCTGATGTCGATCCAGTCGCCGGGACTGGGCATTACGTTGCACCTTCAG
ATTGGAACGCGTTAATCACCTCACCAGATGTTGCTGTCATCGATACCCGC
AACGACTATGAGGTGGGCATCGGAACATTTAATGGAGCTATCGACCCCGA
AACGAAGAGCTTTGGTGAATTCCCTGCATGGTGGGAAGCGAACAAGGATA
GGTTTCATAACAAGAAAATCGCGATGTTCTGTACAGGCGGTATCCGATGT
GAAAAATCAACAAATTACCTGATTGGCCAAGGTGTAGAAGATGTCTACCA
TTTGAAAGGTGGTATCCTAAAATATCTTGAAGAGGTTCCGCATGAAGACA
GCACATGGGACGGTGAATGTTTCGTATTTGATGCACGTGTAAGTGTAGGA
CACGGCCTCAAGGAAGGTCCGCACATGCTTTGTTACGCTTGCCGCCGACC
AATACTTCCAGCGGATCGTGAACACCAAGCGTTTGAAGAAGGTGTCTCAT
GCCATCAATGCGTAGATGAAAAGACTGACGCTGACAAAGACCGTTTCCGT
GAGCGCCAGAAGCAGGTGGCACTCTCGCGTAAACGCGGCGAAAAGCACAT
GGGCAGTTTATAAGAAGTGTGGTGCTGGGGCCAACAAAAATATGTGGTCC
TTGCCCTTGTGATAAGCCTCGTCTTCGGTGGATTTGGGCATCTCGCAGGC
CTTCCGTTGCCTTGGATGCTGGGGCCAATGATCGGAAACACGGCTGCAGC
CTTACTTGGCGTACCCATCAAAGGGCCTGATAGGCTGAGACCCTTTGTGA
TTCCAATCATTGGGGTGATGTTAGGGTCTTCTGTGACAATGGCGCTGTTT
GCACAGCTCAATGACTGGATACTCACGTTAATACTGTTGCCTCTATTTTT
AGCTGTGGCCGCTGGCGTATCGTTTACCGTCTACTTGCGCATCGGCAAGT
ATGATCATGTCACCGCGTTTTATTCGGCAATGCCCGGTGGATTGAACGAG
ATGTTGATGATGGGTGAAGCAGCAGGCGGCGACGAGAAACGGATTGCGAT
GGCGCATGCCGCTAGGGTCCTTATTGTAATCGTCTTCGTTGTTCTATTTT
TTTGGTTGGCCCTTGGGGTCACAAGCACAGGGTCTGTTGGTTGGATTGGC
ATCAATGACCTGACGCCTGTAGATTATCTAATCCTTGGCCTTTGTGCAGT
TGTCGGCCTTTGGCTAGGCCAGTTTTTGAAATTGCCCGCAGCTCAAATTT
TTGGACCAATGCTATTGAGTGGACTCGCGCATCTTACCGGTATTGTTACC
GTAGCACCGCCAACACTTTTCATTCTCGTTGCTCAATTGGTAATCGGTAC
GGTTATTGGGTCGCGTTTTGTTGGAGTTTCACCAAGAGAGGTTGCCAAAG
ATCTCAGTCTTGCGATCATTTCTGCCCTTTGCATGTTAGCGATTGCTGTT
GGGTTTGCGAAAATGGTTACATGGCGAACCGGAATGGGGCTAAGCCAAGC
CTTCTTTGCATATTCGCCAGGTGGCCTGACGGAAATGTCGCTGCTTTCTC
TCACCATGGGTCAAGACGTAACCTATGTTTCGCTGATGCACCTCATACGC
ATCACAATTGTTATAGCCATTGCACCCTTTGTATTTAGCAAAGTGATTGG
CAAAAGATCATAAGTTAGCGAACAATAAACTCAGCGTGAAGAGCACCGCT
TGCCTTTATGCTTTTCAAGATATCAATCATATCCCTCGGGGCAACACCAA
GCGCATTTAGACCTGCGACCACTTCACTCAAAGATGTGCCTTCCCGAATT
TCAGCAAGACCAATCCCCTGCTCTTCTTCAATACCAACATTCGTTCGTGG
TACGATCAAAGTCTCGCCAGGTGAAAACGGGTTTGGTTGTGACACTAACG
GCGCTTCCTCAATGCGGAGCGTAAGCCCGCCTTGACTAACGGCGACACGA
CTAATGCGCACATCATCCCCCATTACGATTGTGCCTGAGCGCTGATCAAT
CACAACACGTGCCCTGCGCTCAGGTTCCACTAAAATATTTTCTATCTGCC
CAAGCGCATGTGCGGGCGACCTGGCCTGCGTTCCAACGATGTCAATCTGA
ACCGTACCCGCATCAAGCATGAGCGCCACTTGGTTTCCAAATGTTGCGTT
TATCGCCTGCTCAATACGCGCTGCCGTTGTGAAGTCGGGTGTCCGCAGCG
CAAGCCGTAGACTGGTCAGCCCAGTAAAGTCGAAATCAACTTCACGCTCA
ATAATTGCCCCTGATGGCACGACCCCCGCAGTTGGGACACCTTGCGTAAC
ACGAGCACCTTGCCCTTCAGCAGTCACCCCACCTGCAATTATCGACCCTT
GAGCAACTGCGTATATTTCACCGTCTGCTGCATTCAATGGGGTCATAATG
AGTGTTCCACCAAGTAAACTTGTCGCATCGCCGATTGCCGAAACCGTGAC
ATCCATTGGACTGCCTGCCCGCGCAAATGGTGGTAAGCTGGCGGTAACAA
GAACGGCTGCGACATTCTTTGGCCGAAATTGTTCACCAGTTACATTAACG
CCTAGGCGCTCAAGAATGTTTGTCATTATTTCTTCAGTGAACGGCGCGTT
ACGCAAACCATCACCGGTGCCGTTAAGGCCTACAACCAACCCATACCCCA
ACAAATTATTAGGTCGCACGCCATCGAATTCGACAAGGTCTTTCAAACGA
ATTGGTGTCGAAGATGCCGTCACTGGAATGGCCCAGCACAAAAGGATGAT
AAAAACACATTTCAATCGCTTCAACGAAGATACTCCACTAAGCTTAGTCT
CGATAGTCTCGCCGTCATAGCATAATGTGTCTCAAGCTGTAGCTGCACAG
CCTTCAACTCTGTAGCAACTTCAAATGGATCAGCCTGAGTGATCAAATTG
CGGGCCATGCTAAGTGCAGAAATCTCAGAACTTTGCGAAATCGCAATGCG
TTCGACTTCGCCTTCAAAATGACCGATACGCCCCTTTACCTGCGCTAGAT
CATCTGCCGCTGATTGTAATTGTAGACCACCCTCAAAAAGCAATGCTGCT
TGCGTCCGCTTGTCTAATCCTAGCAGTTCCTGACCAACTACAGCAAGAAC
AGCACCCTTCAAAACGGCTTTGATACCTGCATCGTCTGCCCGCACACCAA
GCTTTATTCGCGTATCGTTGTCCAAGTGTCGCTCTGGTTTCTCACCTAAA
TCACCTTGATATCCAAGGGTCAAAAATCCGCCTGCGGGGTCATCAAACCA
TGTATCCACAGTTGCAGTAATGACGTTAAAATCTGTACTCCCTCCAATCT
GTGTCACTATATCGGCCAACATCACAGCAGGCGATGTCAAAGCAGCTTGG
CTAACTGCGGTCCCAGAGAAAAGACTTTCGTCACCTAAACGTGTGTTAAG
CGTACTCACTAATCCATCAAAACTATTGCGCGCGGCTCGCGAAGCCTCTT
CAATTTGAAAATCGGAACTGTCAGGGATGACAAGTAAAAGTGAACCCGTC
ATCGCATCTCGTTTACTGTCAAAATTATCCAATAAGACTTGAGTCGTTGA
CAATGTTTGTTGGGTTTCCTTGATCGACTGTGAAAAAGAGTCCAGCACTT
TCAAACGATTATCAATAGCATTAAAGCGTGTAGTATCGCCGCCTGATGCT
TTGACTTTATCACTGACTTCCCCACTGCTGAGCTGTCCTGTTAGGCTATT
CAAAGCAGTTTTTAAGGCAGTGTTGTTACGTTGAAGGTGAAAGTGCTGCA
TGCCATCACCCAGTGACGCAAAATTCATATCTAAATATCCAACAGGCGCG
ACATCATCGCGTCTAGCGTTTGTATAACACGTGCGTTTGCTGCGTAAGAC
TGCTCAATCCGTAAGAGTCGTTGTAATTCTTGATCACTGTCGACCCCACC
CGAGAGCTCGGCGGATTTCAGGCTGTCGTATCTTGCGATTTCAAAACCTA
AGCTTTCTTCAGCGTTGAGCCGCAATCGGCCAACAGTGGCAACTTGATCG
CTTCCGTGCTCAATTGCACTGCGCGCCATGCCACCAACTGATAAGGCGAT
TGGGTCATCCAGGGCGCTAAGCCAGCGTTGCAATTGACTGTTGTCTCCAG
TCGGACCGGACGCAGTTGCGTTAACGCCATGTCGTAGTCTTGAGAGCGCT
CCTCCTTCGCGAGGATCAACAGATGTATTCACTGTTATCCGGGAAGACAG
TCCATCAATATTCAATGGGTCAAATGCCCCATTGTGATCGAGGAAAAGAC
CCGGATCCCCTAAGGTCAGCGTAGGATCAGTTACTGGTCGCTCAAATCGC
TTTACTAAATCAGCCGCAACTTTATCTAAGTTGGCTTGCAGCCCTACCAA
GGTTTGATCACGCAATGTAAAAGCTGCTTCTAGTGAACCACCCTTCATTC
GCCCATAACCATTCGCCAAATCCAGCGGTTCACCGTTCAAAGTCACGCCA
GACAGTGCGCCCAAGACTAGCGTCATTTCAGCGACAATCGTGCCAGTATG
GGCAAATCCAAATGTTGCTGGTGCGCCATCAATCAGCGCGACCCCACTGC
GCGTGTAGAGAGCGACCTGACCACGACCTCTGTTGATCTCAGTCAAAGGA
ACGATCGAGGTCAACCTATCAATTGCATTTTGGCGCGCATCAAACACAGG
TGATGGGTCGTTCCCGGATCCTATCAAACGCGATACATCAGCGTTGAGTT
TCTCAATCTGCAGAAGAGTACTGTTCAAGGTCTTAACATCGGCTGTAATC
GCTTTGTCAGCGTCTTGCCTTTGAATTTGGATTGCGTCATCATCAGAGTG
GAGGGCTGTTGTAACTCCCTCAAGTCCAGAAAAAACTATATTCAGCCTTT
GATCTGACGAAGGACGACTGCTTGCACTTATCAACGATTGTTCCAGCGCT
GCCAGTCTCCCGACGACACCACTGGGGTCACCGACTGGACCAAAGGCCTG
TTCTAATTGAGATAAAACCTGCGCCCCGCGTTGTTTTGACCCAACATCTG
CATCTGCAGTCCGACGATCACGCAAAATTCCAGGATCAACAACACGCGAA
ATTCCATCAAGCACGACACCGCCAAGGAGGCCCGATGACAAGTTTACCTC
TCGCCGCCCATAGCCTTCTGTCAGAGAATTGGAAAGGTTAGAAGACACGA
CTTCAGCCATGCGCGCGGAGGCGGATAACCCGCCCGTCGCATTGTTGAAA
GCACTCGAAATAGTCATATCTTCATCCCTTTAATCTAAGGCCTAGCGCTT
AATGTTCGTCGTTTCTTGCAACATTTCATCAACCGTTTGGATGACCTTTG
CATTCGACGAATACGCGCGCTGCGTTTGGATAAGCTGAGTCAATTCACCC
GCTACGTCGGTTGAAGATTCTTCGCGTGCAAAGCTGACGACATCCCCGGT
TGGGCCATCACCAGCGTCCCATAAGAAAAATGTCCCGCTATCTGGCGACA
CCCGATAACTTTGTTGATCGAGTGACTCGAGACCATTCACGTTCGAAACG
TCAACCAGTGGAACTTGGTAAAGAACACGGTTGATACCACTATCAAACGA
CGCGCGGACGAACCCGTTAACGTCAACGTCAATTGCAGTCAAACTTCCAA
CTGCTGACCCATTCTTAGATATAGACGTTGGTGCGAATGTGTCAGACAAC
TGCGTCAGGCCCGTCGCGCTCCCCAATGTCCCAATGGCCAGTTCAAGCGG
TCCGCCATCTACATTCAAGGTCACCGAACCCGTCGCCGGATCGTATTCAG
TAGGTAGGCCAACACCTAAATTATCTGTGACACCCAACAAAGTGCCCCCA
CCCGCCCTTGATGGATCAAAACTCAACTGATAACTGCCAACGACTGCACC
ACCGCCCGCAGAATCGGCAATCTGCAATTGCCATTCATTTGCGGTTCCAG
TCGCAGGCACAGTGGGCGTGAACGTCATGAGCAGATTTGCCGACTTGCCG
AGGTTATCAAAATACTCGATCGACAACGTTTCATCGCCCGTGGCTGAACC
CGCCTCTGTCGACGTGGCCGGTAAATTCACAGCAAGGTTAACTTCGGTTG
TAGGCTCACCAGCGAATTGGTTACTATTGATCTTTATTGGCTCTAACCCA
TCAACCGAGTCACGTGGATTTGTTGGGATTGTCCCATCAGCATTCGCAGC
CCACCCCATCAAAACAAGACCCGACGGACTACGCAAATATCCATCTTCAT
CTGGACGAAATGAACCGGTAGTCGTCAAAAGAAGTGGGTGATCACCGTTT
GCAACTTGAACTGACGCTTCTGAGGTGACGGGCAACAAACCACGCCCACG
GACCGCAAGGTCAGTTGGGTTTGTCGTCGAAACGAGCGACCCACGTTCAT
CGATCAAACGGGTTGTCGTAGTCCGCACACCACCAGCTGTGTATTTGCTA
TTACTGTTCTCAATCACAAGAGACTGGAAGTCAGTGACCGCCCGTTTATA
TCCAAACGTCGAGGAATTCGCAATATTGTCAGAAATCGTCGCAAGCCGCG
TGGCGTTCGCGGACAAACCCGCAACACCTGCATTGAGGGAAGAGGAGATC
GTCATTTTGGGGCCTTTCTACTTCAGGTCTGACTGCTTCCCTCAATGCCT
AACCGGTTTTCTCTTAACGCCACCCTAACTAGGCAAATTTTAGATATCAC
TTCTTAAAATAATAACTTCAATTCGGTTATTACGAACGGCTGTATGGTCT
TCCAACACAGGGTCACGGTCGGCCTCACCAGTGGTTCGCACAATTTTTTG
T